Null and Alternatively Expressed Alleles
Assigned as of December 2024
Here are listed all the HLA alleles that have been shown to be either not expressed (Null alleles that have the suffix 'N'), or the alleles that have been shown to be alternatively expressed have the suffix 'L', 'S', 'C', 'A' or 'Q'.
The suffix 'L' is used to indicate an allele that has been shown to have 'Low' cell surface expression when compared to normal levels. The 'S' suffix is used to denote an allele specifying a protein which is expressed as a soluble, 'Secreted' molecule, but is not present on the cell surface. A 'C' suffix is used to indicate an allele product which is present in the 'Cytoplasm', but not on the cell surface. An 'A' suffix is used to indicate an 'Aberrant' expression, specifically where there is some doubt as to whether a protein is expressed at all. A 'Q' suffix is used when the expression of an allele is 'Questionable' given that the mutation seen in the allele has previousÏly been seen in other aleles and shown to affect normal expression levels.
As of March 2018, there are no alleles which have been named with the 'C' or 'A' suffix.
All numbering and descriptions are based on an alignment to the exon sequence of the standard reference allele for that locus e.g. A*01:01:01:01 for null HLA-A alleles. A full explanation of how the mutations are described is provided after the table.
Null Alleles
Allele | Mutation | Description of Mutation | References |
---|---|---|---|
A*01:01:01:02N | Deletion | Intron 2, g478-481delGTGA, causes translation of intron 2 sequence and an abnormal truncated peptide | |
A*01:04:01:01N | Insertion | Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 |
Tissue Antigens (1997) 50:347-350 Tissue Antigens (1999) 54:300-302 Tissue Antigens (1999) 54:300-302 Tissue Antigens (1999) 54:300-302 Transplantation (1999) 67:1336-1341 |
A*01:04:01:02N | Insertion | Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | |
A*01:11N | Point | Exon 3, 968G>T, causes alternative splice site at the end of exon 3, resulting in a deletion of 24bp, which affects expression |
Human Immunology (2005) 66:912-920 Human Immunology (2005) 66:912-920 |
A*01:15N | Deletion | Exon 3, 559delC, in codon 163, causes frameshift and premature stop at codon 189 |
Tissue Antigens (2006) 67:61-63 Tissue Antigens (2009) 73:364-372 |
A*01:16N | Insertion | Exon 3, 532-533insG, in codon 154, causes frameshift and premature stop at codon 196 | HLA (2018) 92:304-309 |
A*01:18N | Point | Exon 2, 214-216CGG>CCG, causes R48P, which may effect the binding of beta-2 microglobulin | American Journal of Clinical Pathology (2004) 122:185-192 |
A*01:22N | Deletion | Exon 4, 751delG, in codon 272, causes frameshift and premature stop at codon 272 | |
A*01:27N | Point | Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161 | Human Immunology (2008) 68:913-914 |
A*01:31N | Point | Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 | Tissue Antigens (2010) 76:149-150 |
A*01:52:01N | Point | Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 | Tissue Antigens (2014) 83:184-189 |
A*01:52:02N | Point | Exon 3, 471G>A, causes W133X, a premature stop at codon 133 | HLA (2017) 90:79-87 |
A*01:53N | Point | Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159 | |
A*01:56N | Point | Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217 | |
A*01:57N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 |
Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 |
A*01:87N | Deletion | Exon 4, 723delG, in codon 217, causes frameshift and premature stop at codon 272 | |
A*01:123N | Deletion | Exon 3, 610delC, in codon 180, causes frameshift and premature stop at codon 189 | Human Immunology (2015) 76:30-35 |
A*01:160N | Point | Exon 3, 535C>T, causes Q155X, a premature stop at codon 155 | |
A*01:162N | Point | Exon 2, 286C>T, causes L72X, a premature stop at codon 72 | HLA (2016) 87:31-35 |
A*01:178N | Point | Exon 3, 564C>A, causes C164X, a premature stop at codon 164 | |
A*01:179N | Point | Exon 3, 580A>T, causes R170X, a premature stop at codon 170 | |
A*01:186N | Point | Exon 2, 166C>T, in codon 32, causes Q32X, a premature stop at codon 32 | |
A*01:240N | Point | Exon 2, 235G>T, causes E55X, a premature stop at codon 55 | |
A*01:247N | Insertion | Exon 2, 270insA, in codon 66, causes frameshift and premature stop in codon 74 | |
A*01:250N | Deletion | Exon 2, 261-262delGA, in codons 63-64, causes frameshift and premature stop in codon 73 | |
A*01:258N | Point | Exon 3, 511-513TGG>TGA, causes X147, a premature stop in codon 147 | |
A*01:269N | Point | Exon 2, 232-234CAG>TAG, causes X54, a premature stop in codon 54 | |
A*01:285N | Insertion | Exon 2, 114insCGTCC, in codon 14, causes a frameshift and premature stop at codon 54. | |
A*01:287N | Insertion | Exon 4, 628insC, in codon 186, causes a frameshift and premature stop in codon 196 | |
A*01:290N | Deletion | Exon 3, 540-541delGA, in codons 156-157, causes a frameshift and premature stop at codon 195 | HLA (2023) 101:507-512 |
A*01:293N | Insertion | Exon 3, 562-569insAGGGCCGG, in codon 164, causes a frameshift and premature stop at codon 192 | |
A*01:308N | Point | Exon 3, 367-369TAT>TAA, causes Y99X, a premature stop at codon 99 | HLA (2019) 94:312- |
A*01:320N | Deletion | Exon 3, 450-466delGAACGAGGACCTGCGCT in codons 126-132, causes frameshift and premature stop at codon 190 | |
A*01:326N | Deletion | Exon 2, 280delC, in codon 70, causes frameshift and premature stop at codon 97 | |
A*01:328N | Point | Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop at codon 224 | |
A*01:336N | Deletion | Exon 2, 291-294delTGAC, in codons 73-74, causes frameshift and premature stop at codon 96 | |
A*01:355N | Deletion | Exon 2, 191delCC in codon 40, causes frameshift and premature stop at codon 73 | |
A*01:361N | Point | Exon 3, 415-417CAG>TAG, causes X115, a premature stop at codon 115 | |
A*01:379N | Deletion | Exon 4, 626delC in codon 185, causes frameshift and premature stop at codon 189 | |
A*01:384N | Point | Exon 2, 151-153TAC>TAA, causes X27, a premature stop at codon 27 | |
A*01:394N | Insertion | Exon 3, 507insC, in codon 146, causes a frameshift and premature stop in codon 196 | |
A*01:400N | Point | Exon 2, 223-225TGG>TAG, causes X51, a premature stop at codon 51 | |
A*01:411N | Point | Exon 4, 799-781AAG>TAG, causes K243X, a premature stop in codon 243 | |
A*01:417N | Deletion | Exon 3, 457-465delCCTGAACGAGGACCTGCGC in codon 125, causes a frameshift and premature stop at codon 183 | |
A*01:418N | Deletion | Exon 3, 574delC in codon 168, causes a frameshift and premature stop at codon 189 | |
A*01:420N | Deletion | Exon 4, 751delG in codon 227, causes a frameshift and premature stop at codon 272 | HLA (2023) 101:143-145 |
A*01:421N | Deletion | Exon 4, 730delGATGGGGAGG in codon 220, causes a frameshift and premature stop at codon 269 | |
A*01:433N | Deletion | Exon 4, 843delC, causes a frameshift and premature stop in codon 257 | |
A*01:450N | Deletion | Exon 3, 582delGA in codon 170, causes a frameshift and premature stop at codon 195 | |
A*01:451N | Deletion | Exon 2, 123delC in codon 17, causes a frameshift and premature stop at codon 52 | |
A*01:452N | Insertion | Exon 2, 111insGTGTC in codon 13, causes a frameshift and premature stop at codon 54 | |
A*02:15N | Point | Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 | Immunogenetics (1996) 43:1-5 |
A*02:32N | Point | Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | Tissue Antigens (2000) 55:31-36 |
A*02:43N | Insertion | Exon 4, 779-780insC, in codon 236, causes frameshift and premature stop at codon 264 | |
A*02:53:01N | Point | Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84 | Tissue Antigens (2002) 59:328-330 |
A*02:53:02N | Point | Exon 2, 322-324TAC>TAA, causes X84, a premature stop at codon 84 | |
A*02:82N | Point | Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
A*02:83N | Point | Exon 4, 829-831GAG>TAG, causes Q253X, a premature stop at codon 253 | Tissue Antigens (2005) 66:335-337 |
A*02:88N | Point | Exon 3, 418-420GAC>TAG, causes D116X, a premature stop at codon 116 | |
A*02:94N | Deletion | Exon 2, 337delG, in codon 89, causes frameshift and premature stop at codon 126 | |
A*02:113:01N | Point | Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 |
Tissue Antigens (2008) 72:176-177 Human Immunology (2018) 79:763-772 |
A*02:113:02N | Point | Exon 2, 250-252TGG>TGA, causes W60X, a premature stop at codon 60 | |
A*02:125N | Deletion | Exon 2, 261delG, in codon 63, causes a frameshift and premature stop at codon 67 | Tissue Antigens (2009) 74:424-428 |
A*02:222N | Point | Exon 3, 451-453AAA>TAA, causes K127X, a premature stop at codon 127 | |
A*02:223N | Point | Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 | Tissue Antigens (2014) 83:184-189 |
A*02:225N | Point | Exon 3, 439-441TAC>TAA, causes Y123X, a premature stop at codon 123 | Tissue Antigens (2014) 83:184-189 |
A*02:226N | Point | Exon 3, 538-540TTG>TAG, causes L156X, a premature stop at codon 156 | |
A*02:227N | Point | Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 |
Tissue Antigens (2013) 81:46-47 Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 |
A*02:250N | Deletion | Exon 2, 286-287delCA, in codons 71-72, causes frameshift and premature stop at codon 195 | |
A*02:284N | Point | Exon 3, 391-393TGG>TAG, causes W107X, a premature stop at codon 107 | |
A*02:301N | Deletion | Exon 3, 426delC, in codon 118, causes frameshift and premature stop at codon 118 | |
A*02:305N | Deletion | Exon 4, 814delG, in codon 248, causes frameshift and premature stop at codon 272 | Tissue Antigens (2012) 79:130-131 |
A*02:314:01N | Point | Exon 3, 408-411 TAC>TAG, causes Y113X, a premature stop at codon 113 | |
A*02:314:02N | Point | Exon 3, 408-411 TAC>TAA, causes Y113X, a premature stop at codon 113 | |
A*02:321N | Point | Exon 2, 244-246GAG>TAG, causes Q58X, premature stop at codon 58 | |
A*02:350N | Point | Exon 2, 337-339GAG>TAG causes E89X, a premature stop at codon 89 | Tissue Antigens (2014) 83:184-189 |
A*02:356N | Point | Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 | Tissue Antigens (2013) 82:136-137 |
A*02:366N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | Tissue Antigens (2014) 83:184-189 |
A*02:373N | Point | Exon 3, 514-516GAG>TAG, causes E148X, a premature stop at codon 148 | |
A*02:395N | Point | Exon 2, 268-270AAA>TAA, causes K66X, a premature stop at codon 66 | Tissue Antigens (2013) 81:451-452 |
A*02:439N | Point | Exon 3, 553-555GAG>TAG, causes E161X, a premature stop codon at 161 | |
A*02:468:01N | Point | Exon 3, 571573TGG>TGA, causes W167X, a premature stop codon at 167 | HLA (2017) 90:171-173 |
A*02:468:02N | Point | Exon 3, 571-573TGG>TAG, causes W167X, a premature stop codon at 167 | |
A*02:476N | Point | Exon 3, 511-513TGG>TGA, causes W147X, a premature stop codon at 147 | HLA (2017) 90:171-173 |
A*02:490N | Point | Exon 3, 373-375TGC>TGA, causes C101X, a premature stop codon at 101 | |
A*02:501:01N | Point | Exon 3, 583-585TAC>TAG, causes Y171X, a premature stop codon at 171 | |
A*02:501:02N | Point | Exon 3, 583-585TAC>TAG, causes X171, a premature stop at codon 171 | |
A*02:506N | Insertion | Exon 4, 736-737insG, in codon 222, causes frameshift and premature stop at codon 264 | |
A*02:514N | Point | Exon 2, 247-249TAT>TAG, causes Y57X, a premature stop at codon 59 | |
A*02:516N | Point | Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101 | HLA (2016) 87:31-35 |
A*02:525N | Point | Exon 2, 151-153TAC>TAA, causes Y27X , a premature stop at codon 27 | |
A*02:540N | Point | Exon 3, 367-369TAT>TAG, causes Y99X, a premature stop at codon 99 | |
A*02:608N | Point | Exon 4, 835-837CAG>TAG, causes Q255X, a premature stop at codon 255 | |
A*02:622N | Point | Exon 3, 418-420TAC>TAA, causes D116X, a premature stop at codon 116 | HLA (2016) 88:38- |
A*02:643N | Point | Exon 3, 418-420TAC>TAG, causes Y116X, a premature stop at codon 116 | HLA (2017) 90:362-364 |
A*02:675N | Deletion | Exon 4, 788delG, in codon 239, causes frameshift and premature stop at codon 164 | HLA (2018) 91:187-194 |
A*02:691N | Deletion | Exon 4, 740delA, in codon 223, causes a frameshift and premature stop at codon 272 | |
A*02:696:01N | Point | Exon 3, 549C>A, causes Y159X, a premature stop at codon 159 | HLA (2020) 96:202-203 |
A*02:696:02N | Point | Exon 3, 547-549TAA>TAG, causes X159, a premature stop at codon 159. Is a silent variant of A*02:696N | |
A*02:710N | Point | Exon 5, 907C>T, causes Q279X mismatch, causes premature stop in codon 279 | |
A*02:715N | Deletion | Exon 2, 91delT, in codon 7, causes frameshift and premature stop in codon 52 | |
A*02:748N | Point | Exon 2, 325-327TAC>TAA, causes X85, a premature stop in codon 85 | |
A*02:760N | Point | Exon 1, 19-21CGA>TGA, causes X-18, a premature stop in codon -18 | |
A*02:773N | Point | Exon 3, 562-564TGC>TGA, causes X164, a premature stop in codon 164 | |
A*02:775N | Point | Exon 3, 433-435AAG>TAG, causes X121, a premature stop in codon 121 | |
A*02:788N | Insertion | Exon 3, 612insTGCA, in codon 180, causes a frameshift and premature stop at codon 197. | |
A*02:789N | Point | Exon 3, 424-426TAC>TAG, causes X118, a premature stop at codon 118 | |
A*02:791N | Deletion | Exon 4, 817delG, in codon 249, causes a frameshift and premature stop at codon 272. | |
A*02:792N | Deletion | Exon 5, 941delG, in codon 290, causes a frameshift and premature stop at codon 297 | |
A*02:793N | Deletion | Exon 4, 780delA, in codon 236, causes a frameshift and premature stop at codon 272 | |
A*02:796N | Deletion | Exon 2, 127delG, in codon 19, causes a frameshift and premature stop in codon 52. | |
A*02:797N | Deletion | Exon 3, 474delC, in codon 134, causes a frameshift and premature stop at codon 156. | |
A*02:803N | Deletion | Exon 2, 133delC, in codon 21, causes a frameshift and premature stop at codon 52 | |
A*02:806N | Deletion | Exon 2, 78-79delTC, in codons 2-3, causes a frameshift and premature stop at codon 195 | |
A*02:807N | Deletion | Exon 3, 596-606delGGAAGGAGACG, in codons 175-178, causes a frameshift and premature stop at codon 192 | |
A*02:831N | Deletion | Exon 3, 419delA, in codon 116, causes a frameshift and premature stop in codon 126 | |
A*02:832N | Deletion | Exon 4, 675-679delTAGGT, in codons 201-203, causes a frameshift and premature stop in codon X262. | |
A*02:833N | Insertion | Exon 2, 166insG, in codon 32, causes a frameshift and premature stop at codon 152. | |
A*02:858N | Deletion | Exon 3, 574delC in codon 168, causes frameshift and premature stop at codon 18 | |
A*02:871N | Deletion | Exon 4, 839-840delGA, in codon 256, causes frameshift and premature stop at codon 263 | |
A*02:879N | Insertion | Exon 3, 523insC, in codon 151, causes frameshift and premature stop at codon 196 | |
A*02:880N | Insertion | Exon 3, 610-613insCAGC, in codon 181, causes frameshift and premature stop at codon 197 | |
A*02:887N | Deletion | Exon 3, 384delG, in codon 104, causes frameshift and premature stop at codon 126 | |
A*02:895N | Insertion | Exon 3, 567insCGTG, in codon 166, causes frameshift and premature stop at codon 197 | |
A*02:896N | Deletion | Exon 5, 913-920delACCATCCC, in codons 281-283, causes frameshift and premature stop at codon 312 | |
A*02:915N | Deletion | Exon 4, 751delG, in codon 227, causes a frameshift and premature stop in codon 272 | |
A*02:936N | Point | Exon 4, 724-726CAG>TAG, causes X218, a premature stop at codon 218 | |
A*02:945N | Deletion | Exon 2, 270delA in codon 66 causes frameshift and premature stop at codon 67 | |
A*02:946N | Deletion | Exon 3, 609delG, in codon 179, causes a frameshift and premature stop in codon 189 | |
A*02:989N | Point | Exon 4, 721-723TGG>TGA, causes X217, a premature stop at codon 217 | |
A*02:999N | Point | Exon 3,571-573TGG>TAG, causes W167X, a premature stop in codon 167 | |
A*02:1006N | Insertion | Exon 4, 881insT, in codon 270, causes a frameshift and premature stop in codon 315 | |
A*02:1016N | Deletion | Exon 3, 574delC in codon 168, causes a frameshift and premature stop at codon 189 | |
A*02:1031N | Deletion | Exon 2, 257delGGGAGACA, in codon 62, causes a frameshift and premature stop at codon 71 | |
A*02:1053N | Point | Exon 4, 856C>T causes X262, a premature stop at codon 262 | |
A*02:1055N | Point | Exon 4, 802-804TGG>TGA, causes X244, a premature stop at codon 244 | |
A*02:1059N | Insertion | Exon 2, 248insA in codon 59, causes frameshift and premature stop at codon 59 | |
A*02:1061N | Deletion | Exon 4, 751delG, in codon 227, causes a frameshift and premature stop in codon 272 | |
A*02:1062N | Insertion | Exon 3, 412(1-25)insGACTGGCGCTTCCTCCGCGGGTACC in codon 408 causes a frameshift and premature stop at codon 203 | |
A*02:1063N | Deletion | Exon 3, 411delC in codon 113, causes a frameshift and premature stop at codon 126 | |
A*02:1078N | Insertion | Exon 3, 642insC in codon 191, causes X196, a premature stop at codon 196 | |
A*02:1085N | Deletion | Exon 2, 342delCG in codon 90, causes a frameshift and premature stop at codon 195 | |
A*02:1104N | Insertion | Exon 2, 166insC, in codon 32, causes a frameshift and premature stop in codon 196 | |
A*02:1107N | Point | Exon 2, 127-129GAG>TAG, causes E19X, a premature stop in codon 19 | |
A*02:1119N | Point | Exon 2, 260-263GAG>TAG, causes X63, a frameshift and premature stop at codon 62 | |
A*02:1143N | Point | Exon 3, 454-456GAG>TAG, causes X128, a premature stop at codon 128 | |
A*02:1150N | Deletion | Exon 4, 651delTG in codon 193, causes a frameshift and premature stop at codon X195 | |
A*02:1153N | Point | Exon 2, 127-129GAG>TAG, causes X19, a premature stop at codon 19 | |
A*02:1176N | Deletion | Exon 2, 304delC in codon 78, causes a frameshift and premature stop at codon 126 | |
A*02:1177N | Insertion | Exon 1, 42insC in codon -11, causes a frameshift and premature stop at codon 195 | |
A*02:1184N | Insertion | Exon 2, 96insT in codon 8 causes a frameshift and premature stop at codon 74 | |
A*02:1185N | Point | Exon 3, 535-537CAG>TAG, causes X155, a premature stop at codon 155 | |
A*02:1187N | Deletion | Exon 2, 150delC in codon 26, causes a frameshift and premature stop at codon 52 | |
A*02:1191N | Deletion | Exon 3, 543delG in codon 157, causes a frameshift and premature stop at codon 189 | |
A*02:1195N | Point | Exon 4, 892-894TGG>TAG, causes X274, a premature stop at codon 274 | |
A*03:01:01:02N | Point | Intron 4, g1846G>A, causes incorrect splicing and the insertion of 65bp, resulting in a frameshift and premature stop codon | |
A*03:03N | Deletion | Exon 3, 373-378delTGCGAC, causes deletion of codons 101-102. Codon 101 is necessary for formation of the disulphide bridge | Tissue Antigens (1996) 48:187-191 |
A*03:11:01N | Point | Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
A*03:11:02N | Point | Extends to the 3rd field. Exon 3,424-426TAC>TAG, causes X118, a premature stop at codon 118 | |
A*03:21N | Insertion | Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | |
A*03:36N | Deletion | Exon 2, 264-290delACACGGAATATGAAGGCCCACTCACAG, deletion of codons 64-73, which affects cell surface expression | |
A*03:68N | Point | Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 | Tissue Antigens (2014) 83:184-189 |
A*03:69N | Point | Exon 3, 538-540CGG>TAG, causes R156X, a premature stop at codon 156 | Tissue Antigens (2014) 83:184-189 |
A*03:91N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | Tissue Antigens (2014) 83:184-189 |
A*03:129N | Deletion | Exon 4, 651delC, in codon 193, causes frameshift and premature stop at codon 201 | |
A*03:161N | Point | Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 | |
A*03:162N | Insertion | Exon 4, 664-665insCATG, in codon 198, causes frame shift and premature stop at codon 199 | Tissue Antigens (2014) 83:53-54 |
A*03:168N | Point | Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27 | Tissue Antigens (2014) 83:195-196 |
A*03:178N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | HLA (2016) 87:31-35 |
A*03:192N | Point | Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147 | |
A*03:197:01N | Point | Exon 3, 409-411TAC>TAG, causes Y113X, a premature stop at codon 113 | |
A*03:197:02N | Point | Exon 3, 409-411, TAG>TAA, causes X113, a premature stop at codon 113 | |
A*03:262N | Deletion | Exon 3, 384-393delGGGGCCGGAC, causing frameshift and premature stop at codon 127 | HLA (2017) 90:79-87 |
A*03:266N | Deletion | Exon 3, 543-544delAG, causes frameshift and premature stop at codon 195 | HLA (2017) 90:79-87 |
A*03:269N | Point | Exon 3, 375C>A, causes C101X, a premature stop at codon 101 | HLA (2017) 90:79-87 |
A*03:275N | Point | Exon 2, 225G>A, causes W51X, a premature stop at codon 51 | HLA (2017) 90:109-110 |
A*03:279N | Deletion | Exon 4, 627delC, in codon 185, causes frameshift and premature stop at codon 189 | |
A*03:283N | Point | Exon 2, 252G>A, causes W60X, a premature stop at codon 60 | HLA (2018) 91:61-62 |
A*03:284N | Deletion | Exon 2, 204delG, in codon 44, causes frameshift and premature stop at codon 52 | HLA (2017) 90:79-87 |
A*03:286N | Point | Exon 3, 508A>T, causes K146X, a premature stop at codon 146 | |
A*03:297N | Point | Exon 3, 610-612CAG>TAG, causes X180, a premature stop in codon 180 | |
A*03:323N | Point | Exon 3, 535-538CAG>TAG, causes X155, a premature stop in codon 155 | |
A*03:329N | Deletion | Exon 2, 155-156delGT, in codon 28, causes a frameshift and premature stop in codon 73 | |
A*03:330N | Deletion | Exon 2, 291-292delTG, in codons 73-74, causes a frameshift and premature stop in codon 151. | |
A*03:334N | Insertion | Exon 3, 508insC, in codon 146, causes a frameshift and premature stop at codon 152 | |
A*03:335N | Insertion | Exon 2, 160insGTCG, in codon 30, causes frameshift and premature stop at codon 75 | |
A*03:336N | Deletion | Exon 4, 691-703delGGCTTCTACCCTG, in codons 207-211, causes frameshift and premature stop at codon 211 | |
A*03:337N | Insertion | Exon 3, 429-451insCGGCAAGGATTACATCGCCCTGA, in codon 127, causes a frameshift and premature stop at codon 134 | |
A*03:342N | Insertion | Exon 3, 564-567insCGTG, in codon 166, causes a frameshift and premature stop at codon 197 | |
A*03:357N | Insertion | Exon 3, 511insT in codon 147, causes frameshift and premature stop at codon 152 | |
A*03:364N | Deletion | Exon 2, 251delA in codon 59, causes frameshift and premature stop at codon 67 | |
A*03:374N | Deletion | Exon 1, 36-49delACTCTCGGGGGCCC, in codons -13--8, causes frameshift and premature stop at codon 69 | |
A*03:381N | Point | Exon 3, 454-456, GAG>TAG, causes X128, a premature stop at codon 128 | |
A*03:400N | Deletion | Exon 2, 254delA, in codon 61, causes a frameshift and premature stop in codon 67. | |
A*03:402N | Insertion | Exon 3, 611-614insCAGC in codon 181, causes frameshift and premature stop at codon 197 | |
A*03:404N | Point | Exon 3, 514-516GAG>TAG, causes X148, a premature stop at codon 148 | |
A*03:408N | Insertion | Exon 3, 512insAAGT in codon 147, causes frameshift and premature stop at codon 147 | |
A*03:448N | Point | Exon 3, 571-572 TGG>TGA causes X167, a premature stop at codon 167 | |
A*03:463N | Point | Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop in codon 72 | |
A*03:483N | Deletion | Exon 3, 485delATGGCGGCTCAGAT in codon 138, causes a frameshift and premature stop at coon 147 | |
A*03:494N | Deletion | Exon 3, 397delC in codon 108 causes a frameshift and premature stop at codon 126 | |
A*03:504N | Deletion | Exon 2, 282delA in codon 70, causes a frameshift and premature stop at codon 97 | |
A*11:21N | Insertion | Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | |
A*11:69N | Point | Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217 | Tissue Antigens (2014) 83:292-293 |
A*11:78N | Deletion | Exon 2, 285-286delAC, causes frameshift and premature stop at codon 73 | Tissue Antigens (2011) 77:257-258 |
A*11:99N | Deletion | Exon 2, 153delC, in codon 27, causes frameshift and premature stop at codon 27 | |
A*11:109N | Point | Exon 3, 511-514TGG>TGA, causesW147X, a premature stop at codon 147 | |
A*11:115N | Point | Exon 2, 151-153TAC>TAA , causes Y27X, a premature stop at codon 27 | |
A*11:127N | Point | Exon 3, 583-585TAC>TAA , causes Y171X, a premature stop at codon 171 |
Tissue Antigens (2014) 84:510-511 HLA (2024) 103:- |
A*11:137:01N | Point | Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118 | Tissue Antigens (2014) 83:184-189 |
A*11:137:02N | Point | Exon 3, 426G>A, causes Y118X, a premature stop at codon 118 | HLA (2017) 90:79-87 |
A*11:180N | Deletion | Exon 2, 307delG, in codon 79, causes frameshift and premature stop at codon 97 | |
A*11:208:01N | Point | Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51 | |
A*11:208:02N | Point | Exon 2, 223-225TAG>TGA, causes W51X, a premature stop at codon 51 | |
A*11:210N | Deletion | Exon 4, 642delC, in codon 190, causes frame shift and premature stop at codon 201 | Tissue Antigens (2015) 85:502-504 |
A*11:215N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | |
A*11:238N | Point | Exon 2, 199-201CAG>TAG, causes Q43X, a premature stop at codon 43 | |
A*11:251N | Insertion | Exon 2, 204-205insAG, in codon 44, causes frameshift and premature stop at codon 53 | HLA (2018) 92:167-168 |
A*11:287N | Point | Exon 2, 295-297CGA>TGA, causes X75, a premature stop in codon 75 | |
A*11:310N | Deletion | Exon 3, 546delC, in codon 158, causes a frameshift and premature stop at codon 189 | |
A*11:340N | Insertion | Exon 2, 164insC in codon 31, causes frameshift and premature stop at codon 74 | |
A*11:347N | Insertion | Exon 1, 73insG, in codon 1, causes a frameshift and premature stop in codon 74 | |
A*11:365N | Deletion | Exon 4, 786delT, in codon 238, causes a frameshift and premature stop in codon 272 | |
A*11:382N | Point | Exon 4, 832-834GAG>TAG. causes E254X, a premature stop in codon 254 | HLA (2021) 97:448-449 |
A*11:383N | Point | Exon 1, 67-69TGG>TAG, causes W-2X, a premature stop in codon -2 | HLA (2022) 99:374-375 |
A*11:388N | Point | Exon 1, 61CAG>TAG, causes X-6, a premature stop at codon -6 | HLA (2022) 99:374-375 |
A*11:397N | Point | Exon 3, 547TAC>TAA, in codon 159, causes Y159X, a premature stop in codon 159 | |
A*11:400N | Point | Exon 4, 874-876AAG>TAG, causes X268, a premature stop at codon 268 | |
A*11:403N | Insertion | Exon 1, 73insG, in codon 1, causes a frameshift and premature stop in codon 74 | |
A*11:407N | Insertion | Exon 4 844insTACA, in codon 842, causes a frameshift and premature stop in codon 265 | |
A*11:413N | Deletion | Exon 2, 127delG, in codon 19, causes a frameshift and premature stop in codon 52 | |
A*11:417N | Deletion | Exon 1, 61delC, in codon -5, cause a frameshift and premature stop in codon 5 | HLA (2022) 100:61-62 |
A*11:432N | Point | Exon 3, 547TAC>TAG, causes X159, a premature stop at codon 159 | |
A*11:433N | Insertion | Exon 4, 628insC, in codon 186, causes a frameshift and premature stop in codon 196 | |
A*11:436N | Point | Exon 2, 199-201CAG>TAG, causes X43, a premature stop at codon 43 | |
A*11:452N | Point | Exon 1, 19-21CGA>TGA, causes X-18, a premature stop at codon -18 | HLA (2024) 103:- |
A*11:461N | Point | Exon 2, 331-333CAG>TAG, causes X87, a premature stop at codon 87 | |
A*11:466N | Deletion | Exon 3, 371delG in codon 100, causes a frameshift and premature stop at codon 126 | HLA (2024) 103:- |
A*11:479N | Point | Exon 3, 409-411TAC>TAG, causes X113, a premature stop at codon 113 | HLA (2024) 104:- |
A*23:07N | Insertion | Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | |
A*23:08N | Point | Exon 3, 562-564TGC>TGA, causes c164X, a premature stop at codon 164 | |
A*23:11N | Insertion | Exon 2, 150-151insAGCCCCGCTTCATCGCCGTGGGC, causes frameshift and premature stop at codon 60 | HLA (2018) 92:304-309 |
A*23:19N | Point | Exon 3, 619G>A, in codon 183, mutation occurs at exon boundary, potentially affecting the splice site. Allele shown to be non-expressed. | Human Immunology (2015) 76:286-291 |
A*23:38N | Deletion | Exon 2, 303delC in codon 77, causes frameshift and premature stop at codon 97 | Tissue Antigens (2012) 79:71-72 |
A*23:84N | Deletion | Exon 2, 116-123delCCGGCCGC, in codons 15-17, causes frameshift and premature stop in codon 70 | |
A*23:91N | Point | Exon 1, 67-69TGG>TGA, causes X-2, a premature stop in codon -2 | HLA (2018) 92:408-409 |
A*23:103N | Point | Exon 4, 892-894, TGG>TAG, causes X274, a premature stop at codon 274 | |
A*23:106N | Deletion | Exon 3, 545delC, in codon 158, causes a frameshift and premature stop in codon 189 | |
A*23:108N | Deletion | Exon 3, 559-574delACGTGCGTGGACGGGC, in codons 163-168, causes frameshift and premature stop at codon 184 | |
A*23:142N | Point | Exon 2, 208-210GAG>TAG, causes X46, a premature stop at codon 46 | |
A*24:09N | Point | Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop at codon 224 | Journal of Immunology (1997) 158:5242-5250 |
A*24:11N | Insertion | Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | Journal of Immunology (1997) 158:5242-5250 |
A*24:36N | Deletion | Exon 2, 252-253delGG, in codon 60-61, causes frameshift and premature stop at codon 60 |
Tissue Antigens (2002) 60:184-185 HLA (2017) 90:79-87 |
A*24:40N | Deletion | Exon 4, 626-627delCC, in codon 185, causes frameshift and premature stop codon 195 | |
A*24:45N | Deletion | Exon 2, 101-102delCA, in codon 10, causes frameshift and premature stop codon 73 | |
A*24:48N | Point | Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154 | HLA (2018) 92:304-309 |
A*24:60N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
A*24:83N | Point | Exon 4, 697-699TAC>TAA, causes Y209X, a premature stop at codon 209 | |
A*24:84N | Point | Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
A*24:86N | Insertion | Exon 3, 614-615insGAAGGAGACGCTGCAGC, in codon 181, causes frameshift and premature stop codon 195 | Tissue Antigens (2009) 73:63-65 |
A*24:90:01N | Point | Exon 3, 418-420GAC>TAG, causes Y116X, a premature stop at codon 116 |
Tissue Antigens (2010) 76:319-324 Tissue Antigens (2010) 76:319-324 HLA (2018) 92:304-309 HLA (2018) 92:304-309 |
A*24:90:02N | Point | Exon 3, 420G>A, causes X116X, a premature stop at codon 116 | |
A*24:132N | Point | Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101 | Tissue Antigens (2012) 80:464-465 |
A*24:155N | Deletion | Exon 4, 740delA, causes frameshift and premature stop codon at 272 | Tissue Antigens (2011) 78:267-270 |
A*24:158N | Deletion | Exon 3, 453-454delCG, causes frameshift and premature stop at codon 195 | |
A*24:163N | Point | Exon 4/5, 895-897GAG>TAG, causesW275X, a premature stop at codon 275 | Tissue Antigens (2011) 78:267-270 |
A*24:183N | Point | Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 | Tissue Antigens (2013) 82:136-137 |
A*24:185N | Point | Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 | |
A*24:222N | Deletion | Exon 3, 357delC, in codon 96, causes frame shift and premature stop at codon 97 | |
A*24:232N | Insertion | Exon 2, 113-114insTCCCG, in codon 14, causes a frame shift and a premature stop codon at codon 54 | |
A*24:240N | Point | Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84 | |
A*24:252N | Deletion | Exon 2, 282delC, in codon 70, causes a premature stop at codon 97 | HLA (2017) 90:79-87 |
A*24:278N | Point | Exon 3, 547-549TAC>TAG, causes Y159X, a premature stop at codon 159 | |
A*24:303N | Deletion | Exon 3, 487delG, causes frameshift and premature stop at codon 189 | |
A*24:312N | Point | Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27 | |
A*24:323N | Point | Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | |
A*24:357N | Deletion | Exon 3, 421-431delGCCTACGACGG, deletion of codons 117-119, causes frameshift and premature stop at codon 200 |
HLA (2017) 90:79-87 HLA (2017) 90:79-87 |
A*24:359N | Deletion | Exon 2, 249-250delTT deletion causing premature stop at codon 73 | HLA (2017) 90:79-87 |
A*24:370N | Point | Exon 2, 256G>T, causes G62X, a premature stop at codon 62 | HLA (2017) 90:79-87 |
A*24:388N | Point | Exon 3, 856C>T, causes Q262X, premature stop at codon 262 | HLA (2017) 90:364-365 |
A*24:389N | Deletion | Exon 2, 253delG, in codon 61, causes frame shift and premature stop codon at codon 67 | |
A*24:396N | Deletion | Exon 2, 335-338delGCGA deletion in codon 88-89, causes frameshift and premature stop in codon 96 | |
A*24:408N | Point | Exon 3, 502-504AAG>TAG, causes X144, a premature stop in codon 144 | |
A*24:425N | Point | Exon 2, 331-333CAG>TAG, causes X87, a premature stop in codon 87 | |
A*24:426N | Point | Exon 2, 244-246GAG>TAG, causes X58, a premature stop in codon 58 | |
A*24:427N | Deletion | Exon 4, 627delC, in codon 185, causes a frameshift and premature stop at codon 189. | |
A*24:428N | Point | Exon 2, 250-252TGG>TGA, causes X60, a premature stop at codon 60. | |
A*24:429N | Insertion | Exon 3, 354insT, in codon 95, causes a frameshift and premature stop at codon 196 | |
A*24:430N | Deletion | Exon 4, 651delC, in codon 193, causes a frameshift and premature stop at codon 201. | |
A*24:433N | Insertion | Exon 3, 585insA, in codon 171, causes a frameshift and premature stop at codon 171 | |
A*24:434N | Insertion | Exon 2, 128-131insAGCC, in codon 75, causes frameshift and premature stop at codon 75 | |
A*24:435N | Deletion | Exon 2, 286-287delCA, in codon 73, causes frameshift and premature stop at codon 73 | |
A*24:445N | Insertion | Exon 3, 379insCTCCAGATGATGTT, in codon 103, causes a frameshift and premature stop at codon 131 | |
A*24:448N | Point | Exon 6, 1036-1038CAG>TAG, causes X322, a premature stop at codon 322 | |
A*24:456N | Deletion | Exon 3, 560delC in codon 163, causes frameshift and premature stop at codon 18 | |
A*24:467N | Insertion | Exon 4, 628insC, in codon 186, causes a frameshift and premature stop in codon 96 | |
A*24:514N | Deletion | Exon 3, 571delG in codon 167, causes frameshift and premature stop in codon 189 | HLA (2021) 97:527-529 |
A*24:517N | Point | Exon 2, 286-288CAG>TAG, causees Q72>X, a premature stop in codon 72 | HLA (2021) 97:451-452 |
A*24:518N | Insertion | Exon 2, 208insG, in codon 46, causes a frameshift and premature stop in codon 74 | |
A*24:529N | Insertion | Exon 2, 161insG in codon 30, causes frameshift and premature stop at codon 74 | |
A*24:556N | Deletion | Exon 2, 219-295delTGAC, in codon 74, causes a frameshift and premature stop at codon 95 | HLA (2023) 102:343-347 |
A*24:567N | Deletion | Exon 2, 129delG, in codon 26, causes a frameshift and premature stop in codon 52 | HLA (2023) 102:611-612 |
A*24:568N | Deletion | Exon 4, 893-896delGGG, causes a frameshift and premature stop in codon 274. | |
A*24:576N | Deletion | Exon 4, 859delCATGA in codon 263, causes a frameshift and premature stop at codon 313. | |
A*24:586N | Insertion | Exon 2, 150-151insAGCCCCGCTTCATCGCCGTGGGC, causes frameshift and premature stop at codon 60 | |
A*24:596N | Point | Exon 1, 67-69TGG>TGA, causes X-2, a premature stop at codon -2. | |
A*24:597N | Point | Exon 3, 415-418CAG>TAG, causes X115, a premature stop at codon 115 | |
A*24:608N | Deletion | Allele has a large deletion which begins in intron 3 g1001 and continues through the rest of the sequence | HLA (2024) 103:- |
A*24:623N | Point | Exon 2, 199-201CAG>TAG, causes X43, a premature stop at codon 43 | |
A*24:625N | Deletion | Exon 3, 599-611delAGGAGACGCTGCA in codon 176-180, causes a frameshift and premature stop at codon 185 | |
A*24:636N | Deletion | Exon 3, 455delA in codon 128, causes a frameshift and premature stop at codon 189 | |
A*24:641N | Insertion | Exon 2, 326insA in codon 85, causes formation of a premature stop at codon 85 | |
A*25:12N | Point | Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159 | Tissue Antigens (2014) 83:184-189 |
A*25:42N | Point | Exon 3, 553G>T, causes E161X, a premature stop at codon 161 | HLA (2017) 90:79-87 |
A*25:49N | Point | Exon 3, 610-612CAG>TAG, causes X180, a premature stop in codon 180 | |
A*25:69N | Deletion | Exon 2, 80delA, in codon 3, causes frameshift and premature stop at codon 5 | |
A*26:01:01:03N | Point | Intron 4, g1846G>A, causes incorrect splicing and the insertion of 62bp, resulting in a frameshift and premature stop codon | HLA (2016) 88:260-261 |
A*26:11N | Insertion | Exon 3, 516-517insAC, in codon 149, causes frameshift and premature stop at codon 190 | |
A*26:25N | Insertion | Exon 2, 280-281insC, in codon 70, causes frameshift and premature stop at codon 74 | |
A*26:60N | Point | Exon 3, 424-426>TAC>TAG, causes Y118X, a premature stop at codon 118 | Tissue Antigens (2014) 83:184-189 |
A*26:71N | Point | Exon 2, 223-225>TGG>TAG, causes W51X, a premature stop at codon 51 | Tissue Antigens (2014) 83:184-189 |
A*26:107:01N | Point | Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 | Tissue Antigens (2015) 85:502-504 |
A*26:107:02N | Point | Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 | |
A*26:127N | Point | Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154 | |
A*26:145N | Point | Exon 2, 232C>T, causes E54X, a premature stop at codon 54 | |
A*26:161N | Insertion | Exon 3, 454insC, in codon 128, causes frameshift and premature stop in codon 152 | |
A*26:180N | Insertion | Exon 3, 666-669insTCTG, in codon 200, causes frameshift and premature stop at codon 265 | |
A*26:191N | Deletion | Exon 4, 751delG, in codon 227, causes frameshift and premature stop at codon 272 | |
A*26:202N | Point | Exon 1, 61-63, CAG>TAG, causes X-4, a premature stop a codon -4 | |
A*26:206:01N | Point | Exon 3, 393-395TGG>TAG, causes W171X, a premature stop in codon 171 | HLA (2020) 96:717-718 |
A*26:206:02N | Point | Exon 3, 512-514TGG>TGA, causes X147, a premature stop at codon 147 | HLA (2023) 102:750-752 |
A*26:210N | Point | Exon 3, 535-537CAG>TAG, causes X155, a premature stop at codon 155 | |
A*26:230N | Insertion | Exon 2, 137insGGCTACGTGGGCTACG, causes a frameshift and premature stop in codon 79 | |
A*26:240N | Insertion | Exon 3, 523insC in codon 151, cause a frameshift and premature stop at codon 152 | |
A*26:252N | Point | Exon 2, 325-327TAC>TAA, causing X85, a premature stop at codon 85 | |
A*29:01:01:02N | Point | Intron 4, g1846G>T, causes incorrect splicing and the insertion of 62bp, resulting in a frameshift and premature stop codon | Tissue Antigens (2002) 59:139-141 |
A*29:08N | Point | Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51 | |
A*29:78N | Point | Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 | |
A*29:112N | Deletion | Exon 2, 286-287delCA in codon 72, causes a frameshift and premature stop in codon 73 | |
A*29:199N | Deletion | Exon 2, 91delGT in codon 6 causes a frameshift and premature stop at codon 36 | |
A*29:200N | Point | Exon 4, 835-857CAG>TAG, causes X255, a premature stop at codon 255 | |
A*30:27N | Point | Exon 3, 535-537GAG>TAG, causes Q155X, a premature stop at codon 155 | |
A*30:59N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | Tissue Antigens (2013) 82:430-432 |
A*30:70N | Deletion | Exon 2, 208-210delG, in codon 46, causes frame shift and premature stop at codon 52 |
HLA (2018) 92:304-309 HLA (2018) 92:304-309 |
A*30:73N | Insertion | Exon 3, 516-517insCGGACATGGCGGCTCAGATCACCCAGCGCAAGTGGGAG, in codon 148, causes a frame shift and a premature stop codon at codon 169 | |
A*30:76N | Point | Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 | |
A*30:78N | Deletion | Exon2, 188delA, in codon 39, causes a frame shift and premature stop codon at codon 52 | |
A*30:121N | Point | Exon 3, 514G>T, causes E148X a premature stop at codon 148 | |
A*30:123N | Point | Exon 3, 412G>T, causes E114X, a premature stop at codon 114 | |
A*30:130N | Insertion | Exon 4, 628-629insCC, in codon 186, causes frameshift and premature stop in codon 190 | HLA (2018) 92:324-326 |
A*30:132N | Insertion | Exon 4, 628insC in codon 186, causes frameshift and premature stop in codon 196 | HLA (2018) 92:233-234 |
A*30:145N | Insertion | Exon 3, 490insACATGGCG, in codon 140, causes a frameshift and premature stop at codon 159 | |
A*30:158N | Deletion | Exon 3, 509delA in codon 146, causes frameshift and premature stop at codon 156 | |
A*30:178N | Point | Exon 3, 511-513TGG>TGA, causes X147, a premature stop at codon 147 | |
A*30:197N | Point | Exon 3, 598-600AAG>TAG, causes X176, a premature stop in codon 176 | |
A*30:204N | Insertion | Exon 2, 305insT in codon 78, causes X114, a premature stop at codon 114 | |
A*30:208N | Deletion | Exon 4, 751delG in codon 227, causes a frameshift and premature stop at codon 272 | |
A*30:209N | Deletion | Exon 2, 114delG, in codon 14, causes a frameshift and premature stop in codon 52 | |
A*30:219N | Deletion | Exon 2, 133delCC in codon 20, causes a frameshift and premature stop at codon 57 | |
A*31:01:02:03N | Deletion | Intron 1, g176-185delGCGGATCTCA, affecting splice site for intron 1 | |
A*31:14N | Insertion | Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | Tissue Antigens (2006) 68:526-527 |
A*31:60N | Point | Exon 3, 373-375TGC>TGA , causes G101X, a premature stop at codon 101 | |
A*31:126N | Point | Exon 3, 369T>G, causes Y99X, a premature stop at codon 99 | HLA (2018) 91:534-535 |
A*31:131N | Point | Exon 2, 295C>T, causes R75X, premature stop at codon 75 | |
A*31:141N | Insertion | Exon 2, 80insC, in codon 3, causes a frameshift and premature stop in codon 58 | |
A*31:149N | Deletion | Exon 3, 372-382delCTGCGACGTGG, in codons 100-104, causes a frameshift and premature stop at codon 192 | |
A*31:158N | Insertion | Exon 2, 190insG, in codon 40, causes frameshift and premature stop at codon 58 | |
A*31:184N | Point | Exon 1, 67-69TGG>TAG, causes W-2X, a premature stop in codon -2 | HLA (2023) 101:660-663 |
A*31:188N | Deletion | Exon 3, 481delG in codon 136, causes frameshift and premature stop at codon 156 | HLA (2022) 100:70-71 |
A*31:201N | Point | Exon 3, 547-549TAC>TAA, causes X159, a premature stop in codon 159 | |
A*31:202N | Point | Exon 2, 247-249TAT>TAA in codon 59, causes a frameshift and premature stop in codon 59 | |
A*31:232N | Point | Exon 4, 829-831CAG>TAG, causes X253, a premature stop at codon 253 | HLA (2024) 104:- |
A*32:19N | Point | Exon 3, 571-573GGG>TGA, causes G167X, a premature stop at codon 167 | Tissue Antigens (2009) 74:553-554 |
A*32:27N | Point | Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 |
Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 |
A*32:45N | Point | Exon 3, 508-510AAG>TAG, causes K146X, a premature stop at codon 146 | Tissue Antigens (2014) 83:184-189 |
A*32:48N | Point | Exon 3, 409-411 TAC>TAG, causes Y113X, a premature stop at codon 113 | Tissue Antigens (2014) 83:184-189 |
A*32:56N | Deletion | Exon 2, 233delA, in codon 54, causes frameshift and premature stop at codon 67 | |
A*32:92N | Insertion | Exon 3, 617-630insGAGACGCTGCAGCG in codon 181, causes frameshift and premature stop at codon 194 | HLA (2017) 90:79-87 |
A*32:112N | Point | Exon 2, 325-327TAC>TAA, causes X85, a premature stop in codon 85 | |
A*32:117N | Point | Exon 5, 994-996TGG>TAG, causes X308, a premature stop in codon 308 | |
A*32:126N | Deletion | Exon 2, 286-287delCA, in codon 72, causes a frameshift and premature stop at codon 73 | |
A*32:130N | Insertion | Exon 2, 280insC, in codon 70, causes frameshift and premature stop at codon 74 | |
A*32:132N | Point | Exon 3, 373-375TGC>TGA, causes C101X, a premature stop in codon 101 | |
A*32:133N | Insertion | Exon 3, 579insAG, in codon 169, causes frameshift and premature stop at codon 190 | |
A*32:135N | Insertion | Exon 2, 129insA, in codon 19, causes a frameshift and premature stop in codon 37 | |
A*32:160N | Point | Exon 3, 424-426TAC>TAG), causes Y118X, a premature stop in codon 118 | HLA (2022) 100:629-630 |
A*32:167N | Deletion | Exon 2, 200-213delAGAGGATGGAGCC in codon 43, causing a frameshift and premature stop at codon 48 | |
A*32:168N | Deletion | Exon 4, 895delG, in codon 275, causes a frameshift and premature stop in codon 291 | |
A*33:73N | Insertion | Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | HLA (2024) 104:- |
A*33:74N | Point | Exon 4, 802-804TGG>TAG, causes W244X, a premature stop at codon 244 | HLA (2017) 90:365-366 |
A*33:80N | Point | Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118 | HLA (2017) 90:171-173 |
A*33:96N | Point | Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 | |
A*33:123N | Deletion | Exon 2, 320delG, in codon 83 causes frameshift and premature stop codon 97 | HLA (2017) 90:79-87 |
A*33:129N | Insertion | Exon 4, 627-628insC, in codon 186 causes frameshift and premature stop at codon 196 | HLA (2018) 92:243-244 |
A*33:140N | Point | Exon 3, 454GAG>TAG, causes E128X, a premature stop in codon 128 | |
A*33:143N | Deletion | Exon 3, 389delA, in codon 106, causes frameshift and premature stop in codon 126 | |
A*33:154N | Point | Exon 2, 325-327TAC>TAA, causes X85, a premature stop in codon 85 | |
A*33:156N | Point | Exon 4, 856-858CAG>TAG, causes X262, a premature stop in codon 262 | |
A*33:157N | Point | Exon 4, 697-699TAC>TAG, causes X209, a premature stop at codon 209 | |
A*33:174N | Deletion | Exon 3, 656-657delCT, in codon 195, causes a frameshift and premature stop at codon 195 | |
A*33:176N | Deletion | Exon 3, 472-485delACCGCGGCGGACAT, in codons 134-138, causes a frameshift and premature stop at codon 191 | HLA (2019) 94:316-317 |
A*33:194N | Point | Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop in codon 141. | |
A*33:198N | Point | Exon 3, 511-513, TGG>TAG, causes X147, a premature stop at codon 147 | |
A*33:213N | Point | Exon 3, 367-369TAT>TAG, in codon 99, causes Y99X, a premature stop in codon 99 | |
A*33:229N | Point | Exon 3, 439-401TAC>TAG, causes X123, a premature stop at codon 123 | |
A*33:230N | Insertion | Exon 3, 601insG in codon 177, causes a frameshift and premature stop at codon 196 | |
A*33:248N | Deletion | Exon 3, 562delTG, causes a frameshift and premature stop at codon 195 | |
A*33:258N | Deletion | Exon 4, 626delC in codon 185, causes a frameshift and premature stop at codon 189 | |
A*33:261N | Point | Exon 2, 223-225TGG>TAG, causes X51, a premature stop at codon 51 | |
A*33:266N | Point | Exon 3, 475-477GCG>TAG, causes X135, a premature stop at codon 135 | |
A*34:10N | Point | Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 | |
A*34:26N | Deletion | Exon 4, 779delC, in codon 235, causes a frameshift and premature stop in codon 272 | |
A*34:29N | Point | Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop in codon 54 | |
A*34:30N | Point | Exon 3, 409-411TAC>TAA, causes X113, a premature stop at codon 113 | |
A*43:02N | Deletion | Exon 4, 637-638delAT in codon 189, causes frameshift and premature stop at codon 195 | |
A*66:27N | Point | Exon 2, 327-329TAC>TAA, causes Y85X, a premature stop at codon 85 | |
A*66:28N | Deletion | Exon 4, 627delC, in codon 185, causes a frameshift and premature stop at codon 189 | HLA (2018) 92:169-170 |
A*66:39N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature sop in codon 128 | |
A*68:11N | Deletion | Exon 1, 46delG, in codon 9, causes frameshift and premature stop at codon -6 | Tissue Antigens (1999) 53:573-575 |
A*68:18N | Insertion | Exon 2, 213-214insCGAGCCAGAGGATGGAGCCG, between codons 47-48, causes frameshift and premature stop at codon 59 |
Tissue Antigens (2002) 60:88-90 HLA (2017) 90:79-87 |
A*68:49N | Point | Exon 3, 511-513TGG>TAG, causes W147X, a premature stop at codon 147 | Tissue Antigens (2014) 83:184-189 |
A*68:59N | Point | Exon 3, 511-513TGG>TAG, causes W147X, a premature stop at codon 147 | Tissue Antigens (2014) 83:184-189 |
A*68:94N | Point | Exon 2, 253-255TGG>TAG , causes W51X, a premature stop at codon 51 | |
A*68:120N | Point | Exon 3, 385-387TCG>TAG, causes S105X, a premature stop at codon 105 | |
A*68:142N | Deletion | Exon 2, 240delG, in codon 56, causes frameshift and premature stop at codon 67 | |
A*68:171:01N | Point | Exon 3, 540G>A, causes W156X, a premature stop at codon 156 | |
A*68:171:02N | Point | Exon 3, 540G>A, causes W156X, a premature stop at codon 156 | |
A*68:181N | Point | Exon 3, 553-555GAG>TAG, causes X161, a premature stop in codon 161 | |
A*68:182N | Point | Exon 3, 358-360CAG>TAG, causes X96, a premature stop in codon 96 | |
A*68:199N | Insertion | Exon 3, 574-587insTGATCCTCATGGGG, in codon 168, causes a frameshift and premature stop at codon 168. | |
A*68:203N | Deletion | Exon 3, 359delA, in codon 96, causes a frameshift and premature stop at codon 97 | |
A*68:205N | Insertion | Exon 3, 384insG, in coodn 105, causes a frameshift and premature stop at codon 196 | |
A*68:210N | Insertion | Exon 2, 249-262insGTATTGGGACCGGA, in codon 63, causes a frameshift and premature stop at codon 72 | |
A*68:213N | Point | Exon 2, 247-249TAT>TAG in codon 59, causes Y59X, a premature stop at codon 59 | HLA (2021) 97:60-62 |
A*68:216N | Deletion | Exon 1, 61delC in codon -4, causes frameshift and premature stop at codon | |
A*68:236N | Deletion | Exon 2, 134delG in codon 21, causes frameshift and premature stop at codon 52 | |
A*68:245N | Point | Exon 3, 409-411, TAC>TAA, causes X113, a premature stop at codon 113 | |
A*68:251N | Deletion | Exon 2, 132-133delCC, causes a frameshift and premature stop in codon 71 | HLA (2023) 101:660-663 |
A*68:266N | Deletion | Exon 2, 213-233delGCGGGCGCCGTGGATAGAGC in codon 47, causes frameshift and premature stop at codon 67. | |
A*68:267N | Insertion | Exon 2, 228insA in codon 53, causes frameshift and premature stop at codon 74 | |
A*68:269N | Point | Exxon 2, 295-297CGA>TGA, causes X75, a premature stop at codon 75 | |
A*68:281N | Point | Exon 2, 250-252TGG>TGA, causes X60, a premature stop in codon 60 | |
A*68:292N | Deletion | Exon 2, 117delC, in codon 15, causes a frameshift and premature stop in codon 52 | |
A*74:12N | Deletion | Exon 3, 357-362delCCAGAT, causes deletion of codons 95-97. Protein is not detected at cell surface by pan-class I antibody. | |
A*74:14N | Point | Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51 | |
A*74:32N | Point | Exon 3, 424-426TAC>TAG, causes X118, a premature stop in codon 118 | HLA (2023) 101:507-512 |
A*74:47N | Point | Exon 3, 697-699TAC>TAA, causes X209, a premature stop at codon 209 | |
A*80:08N | Point | Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop in codon 224 | |
A*80:09N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop in codon 128 | |
B*07:02:01:126N | Point | Intron 1, g201G>A in the splice site preceding exon 2, which may affect expression | |
B*07:44N | Point | Exon 4, 852T>G, causes alternative splice site at the end of exon 4, resulting in a deletion of 43bp, which affects expression |
HLA (2017) 89:230-234 HLA (2017) 89:230-234 |
B*07:49N | Point | Exon 4, 892-894TGG>TAG, causes W274X, a premature stop at codon 274 | Tissue Antigens (2007) 70:341-343 |
B*07:67N | Deletion | Exon 2, 117delC, in codon 15, causes frameshift and premature stop at codon 34 | |
B*07:111N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 |
Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 |
B*07:135N | Point | Exon 3, 553-555GAG>TAG, causes G161X, premature stop at codon 161 | |
B*07:161N | Insertion | Exon 5, 961insT, in codon 297, causes a frame shift and premature stop at codon 309 | Human Immunology (2018) 79:763-772 |
B*07:167N | Point | Exon 3, 502-504 CAG-TAG, causes Q144X, a premature stop at codon 144 | Tissue Antigens (2014) 83:184-189 |
B*07:181N | Point | Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65 | Tissue Antigens (2014) 83:184-189 |
B*07:182N | Point | Exon 3, 418-420TAC>TAA, causes Y116X, a premature stop at codon 116 | |
B*07:201N | Point | Exon 3, 502-504CAG>TAG, causes Q502X, a premature stop at codon 144 | |
B*07:231N | Point | Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84 | HLA (2016) 87:31-35 |
B*07:251N | Deletion | Exon 3, 535delC, in codon 155, causes frameshift and premature stop at codon 189 | |
B*07:272N | Point | Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at 101 | |
B*07:285N | Deletion | Exon 3, 491delC, in codon 140, causes frameshift and premature stop codon 189 | HLA (2017) 90:79-87 |
B*07:315N | Point | Exon 2, 295-297CGA>TGA, causes X75, a premature stop in codon 75 | |
B*07:316N | Deletion | Exon 2, 201-204delGAGA in codons 44 and 45, causes frameshift and premature stop in codon 51 | |
B*07:318N | Point | Exon 2, 166-168CAG>TAG, causes X32, a premature stop in codon 32 | |
B*07:325N | Point | Exon 2, 280-282CAG>TAG, causes X70, a premature stop in codon 70 | |
B*07:330N | Point | Exon 4, 748-750CAG>TAG, causes X226, a premature stop in codon 226 | |
B*07:343N | Deletion | Exon 3, 610-619delGAGCGCGCTG, in codons 180-183, causes a frameshift and premature stop at codon 186 | |
B*07:351N | Deletion | Exon 2, 264delA, in codon 64, causes a frameshift and premature stop at codon 126 | |
B*07:373N | Deletion | Exon 4, 701delC, in codon 210, causes frameshift and premature stop at codon 215 | |
B*07:374N | Deletion | Exon 5, 896-909delAGCCGTCTTCCCAG in codons 275-279, causes frameshift and premature stop at codon 304 | |
B*07:386N | Deletion | Exon 3, 476-619delGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCGAGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGACAAGCTGGAGCGCGCT, causes the deletion of codons 134-182, which may affect expression | |
B*07:415N | Point | Exon 2, 100-102TAC>TAG, causes X9, a premature stop at codon 9 | |
B*07:425N | Point | Exon 1, 19-21, CGA>TGA, causes X-19, a premature stop at codon -19 | |
B*07:435N | Insertion | Exon 3, 584insA, in codon 171, causes a frameshift and premature stop in codon 171 | |
B*07:446N | Point | Exon 2, 337-339GAG>TAG, causes X89, a premature stop in codon 89 | |
B*07:460N | Deletion | Exon 3, 419delA, causes a frameshift and premature stop in codon 126 | |
B*07:468N | Deletion | Exon 3, 607delC, in codon 179, causes a frameshift and premature stop in codon 189 | |
B*07:469N | Insertion | Exon 3, 451(1-13)insTACATCGCCCTGA in codon 126, causes a frameshift and premature stop at codon 156 | |
B*07:472N | Insertion | Exon 3, 539insCAGCT in codon 156, causes a frameshift and premature stop at codon 158 | |
B*07:479N | Point | Exon 2, 202-203AGA>TGA, causes X44, a premature stop at codon 44 | |
B*07:481N | Deletion | Exon 3, 407delG, in codon 112, causes a frameshift and premature stop in codon 126 | |
B*07:509N | Point | Exon 4, 721-723TGG>TAG, causes X217, a premature stop at codon 217 | |
B*07:520N | Deletion | Exon 3, 480delC in codon 135, causes a frameshift and premature stop at codon 189 | |
B*08:08N | Deletion | Exon 3, 473delC, in codon 134, causes frameshift and premature stop at codon 189 | Tissue Antigens (2000) 55:61-64 |
B*08:19N | Point | Exon 4, 724-726CAG>TAG, causes Q218X, a premature stop at codon 218 | |
B*08:30N | Point | Exon 3,424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
B*08:67:01N | Point | Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51 | |
B*08:67:02N | Point | Exon 2, 223-225TGA>TAG, causes W51X, a premature stop in codon 51 | HLA (2021) 98:55-56 |
B*08:72N | Point | Exon 2, 295-297CGA>TGA, causes R75X, premature stop at codon 75 | Tissue Antigens (2014) 83:184-189 |
B*08:82N | Point | Exon 3, 589-591GAG>TAG, causes E173X, a premature stop at codon 173 | Tissue Antigens (2014) 83:184-189 |
B*08:86N | Point | Exon 3, 571-573TGG>TGA, causes W167X, a premature stop at codon 167 | Tissue Antigens (2014) 83:184-189 |
B*08:148N | Deletion | Exon 3, 263-266delCACA, in codons 64-65, causes frameshift and premature stop at codon 125 | HLA (2017) 90:79-87 |
B*08:214N | Insertion | Exon 3, 351insA, in codon 93, causes a frameshift and premature stop at codon 114. | |
B*08:215N | Deletion | Exon 2, 265-266delCA, in codon 65, causes a frameshift and premature stop at codon 73. | |
B*08:220N | Point | Exon 2, 250-252TGG>TGA, causes X60, a premature stop at codon 60. | |
B*08:236N | Point | Exon 4, 832-834GAG>TAG, causes E254X, a premature stop at codon 254 | |
B*08:252N | Point | Exon 3, 637-639, CAG>TAG, causes X181, a premature stop at codon 181 | |
B*08:279N | Point | Exon 3, 583-585TAC>TAG, causes Y171X, a premature stop in codon 171 | |
B*08:287N | Point | Exon 3, 415-418CAG>TAG, causes Q115X, a premature stop at codon 115 | |
B*08:293N | Point | Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop in codon 141. | |
B*08:328N | Deletion | Exon 2, 224delTG in codon 51, causes a frameshift and premature stop at codon 73 | |
B*13:07N | Deletion | Exon 2, 254-268delACCGGAACACACAGA, codons 61-66, causes no frameshift but exon 2 is 5 amino acids shorter | |
B*13:49N | Point | Exon 3, 439-441TAC>TAA, causes Y123X, premature stop at codon 123 | Tissue Antigens (2014) 83:184-189 |
B*13:56:01N | Point | Exon 3, 424-426TAC>TAA, casues Y118X, premature stop at codon 118 | Tissue Antigens (2014) 83:184-189 |
B*13:56:02N | Point | Exon 3, 424-426TAA>TAG, causes X118X, a premature stop codon at 118 | |
B*13:63N | Insertion | Exon 3, 584-585insA, in codon 171, causes frame shift and premature stop at codon 171 | Tissue Antigens (2013) 81:459-460 |
B*13:76N | Point | Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop at codon 96 | |
B*13:103N | Deletion | Exon 3, 454G>T, causes E128X, a premature stop at codon 128 | HLA (2019) 94:318-319 |
B*13:116N | Point | Exon 5, 907-909CAG>TAG, causes X279, a premature stop at codon 279 | |
B*13:137N | Deletion | Exon 2, 168delG, in codon 32, causes frameshift and premature stop at codon 34 | |
B*13:139N | Point | Exon 4, 682-684, TGG>TGA, causes X204, a premature stop at codon 204 | |
B*13:161N | Deletion | Exon 2, 149delG in codon 26, causes frameshift and premature stop at codon 34. | HLA (2023) 102:343-347 |
B*13:198N | Deletion | Exon 2, 265delCA in codon 65, causes a frameshift and premature stop at codon 113 | |
B*14:07N | Point | Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
B*14:41N | Deletion | Exon 3, 523delC, in codon 151, causing frameshift and premature stop at codon 156 | Tissue Antigens (2015) 86:208-209 |
B*14:69N | Point | Exon 4, 892-894TGG>TGA, causes W274X, a premature stop at codon 274 | HLA (2020) 96:13-23 |
B*14:72N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop in codon 75 | |
B*14:76N | Point | Exon 4, 682-684TGG>TAG, causes W204X, a premature stop at codon 20 | |
B*14:79N | Deletion | Exon 3, 352-353delAC in codon 94, causes frameshift and premature stop at codon 113 | HLA (2023) 101:507-512 |
B*14:85N | Point | Exon 1, 19-21, CGA>TGA, causes X-18, a premature stop at codon -18 | |
B*14:100N | Deletion | Exon 4, 814-815delGG, in codons 247-248, causes a frameshift and premature stop in codon 263 | |
B*14:101N | Deletion | Exon 1, 19delC in codon -18, causes frameshift and premature stop at codon -5 | |
B*14:113N | Point | Exon 5, 907-909CAG>TAG, causes X279, a premature stop at codon 279 | HLA (2022) 100:629-630 |
B*14:131N | Point | Exon 3, 454-456GAG>TAG, causes X128, a premature stop at codon 128 | |
B*14:139N | Insertion | Exon 2, 114insTCCCG in codon 14, causes a frameshift and premature stop at codon 36 | |
B*15:01:01:02N | Deletion | Intron 1, g175-184delCGGGTCTCAG, causes incorrect splicing and the insertion of 74bp, resulting in a frameshift and premature stop codon | Tissue Antigens (1999) 53:244-252 |
B*15:26N | Point | Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 | Tissue Antigens (1997) 50:351-354 |
B*15:79N | Insertion | Exon 2, 328-329insCA, in codon 86, causes frameshift and premature stop at codon 127 | |
B*15:94N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
B*15:111N | Deletion | Exon 3, 527-536delAGGCGGAGCA, codons 152-155, causes frameshift and premature stop at codon 186 | |
B*15:149N | Deletion | Exon 2, 264-265delAC, in codons 64-65, causes frameshift and premature stop at codon 113 | Tissue Antigens (2009) 74:447-449 |
B*15:181N | Point | Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144 |
Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 |
B*15:182N | Point | Exon 2, 91-93TAT>TAG, causes Y7X, a premature stop at codon 7 | Tissue Antigens (2014) 83:184-189 |
B*15:190N | Point | Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147 | Tissue Antigens (2014) 83:184-189 |
B*15:209N | Point | Exon 3, 469-471TGG>TGA, causes W133X, a premature stop at codon 133 | Tissue Antigens (2011) 78:267-270 |
B*15:226N | Point | Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87 | HLA (2016) 88:201-203 |
B*15:246N | Deletion | Exon 2, 264-265delAC, in codon 64-65, causes frameshift and premature stop at codon 113 | |
B*15:258N | Point | Exon 3, 583-585TAC>TAA, causes Y171X, a premature stop at codon 171 | |
B*15:262:01N | Point | Exon 3, 367-369insGACG, in codon 99, causes frameshift and premature stop at codon 115 | |
B*15:262:02N | Insertion | Exon 3, 367-369insGATG, in codon 99, causes a frameshift and premature stop at codon 115 | |
B*15:272N | Point | Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop codon at 118 | HLA (2017) 90:79-87 |
B*15:294N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | HLA (2016) 87:31-35 |
B*15:302N | Deletion | Exon 4, 723delG, in codon 217, causes frameshift and premature stop at codon 314 | |
B*15:304N | Deletion | Exon 2, 137-147delTCATCGCAGTG, in codons 22-25, causes frameshift and a premature stop at codon 110 | HLA (2017) 90:171-173 |
B*15:375N | Deletion | Exon 3, 472-478delACCGCGG, codons 134-136, causes frameshift and premature stop at codon 187 | HLA (2016) 87:104-106 |
B*15:380N | Deletion | Exon 4, 852delT, in codon 261, causes frameshift and premature stop at codon 272 | |
B*15:400N | Deletion | Exon 2, 400-403delCTCC, in codon110, causes frameshift and premature stop at codon 125 | HLA (2018) 92:100-101 |
B*15:454N | Point | Exon 3, 570-572TGG>TAG. causes X167, a premature stopn in codon 167 | |
B*15:463N | Deletion | Exon 3, 437delA, in codon 122, causing a frameshift and a premature stop in codon 126 | |
B*15:483N | Point | Exon 4, 682-684TGG>TAG. causes X204, a premature stop in codon 204 | |
B*15:487N | Deletion | Exon 4, 836delA, in codon 264, causes a frameshift and premature stop in codon 272. | |
B*15:496N | Deletion | Exon 3, 550delC, in codon 160, causes a frameshift and premature stop in codon 189 | |
B*15:528N | Point | Exon 3, 454-456CAG>TAG, causes E128X, a premature stop in codon 128 | |
B*15:540N | Deletion | Exon 2, 214delC, in codon 47, causes frameshift and premature stop at codon 52 | |
B*15:544N | Deletion | Exon 2, 158delA, in codon 29, causes frameshift and premature stop at codon 34 | |
B*15:549:01N | Point | Exon 2, 322-324, TAC>TAG, causes X84, a premature stop at codon 84 | |
B*15:549:02N | Point | Exon 2, 322-324TAC>TAA, causes X84, a premature stop at codon 84 | |
B*15:562N | Deletion | Exon 3, 579delC in codon 169, causes frameshifte and premature stop at codon 189 | |
B*15:575N | Insertion | Exon 3, 424insT in codon 118, causes frameshift and premature stop at codon 152 | |
B*15:584N | Point | Exon 3, 502-504CAG>TAG, causes X144,a premature stop at codon 144 | |
B*15:596N | Point | Exon 4, 682-684TGG>TAG, causes X204, a premature stop at codon 204 | |
B*15:604N | Deletion | Exon 5, 907delC, in codon 279, causes a frameshift and premature stop in codon 294 | |
B*15:669N | Deletion | Exon 2, 310-344delAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG in codon 80, causes a frameshift and premature stop at codon 115. | |
B*15:671N | Point | Exon 2, 286-288CAG>TAG, causes X72, a premature stop at codon 72 | |
B*18:17N | Point | Exon 1, 40-42TCG>TAG, causes W-11X, a premature stop at codon -11 | Tissue Antigens (2002) 59:341-343 |
B*18:23N | Point | Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 | |
B*18:74N | Point | Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161 | Tissue Antigens (2014) 83:184-189 |
B*18:94N | Point | Exon 2, 291-294TAC>TAA, causes Y74X, a premature stop at codon 74 | HLA (2016) 87:31-35 |
B*18:138N | Deletion | Exon 3, 468-469delCT, in codons 132-133, causes frameshift and premature stop at codon 195 | |
B*18:154N | Point | Exon 3, 511-513TGG>TAG, causes X147, a premature stop in codon 147 | |
B*18:182N | Deletion | Exon 2, 281-282delAC, in codon 70, causes frameshift and premature stop at codon 113. | |
B*18:245N | Point | Exon 2, 295-297CGA>TGA, causes X75, a premature stop at codon 75 | |
B*18:248N | Deletion | Exon 1, 3delG in codon 1 causes disruption of start codon | |
B*27:59N | Point | Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 | Tissue Antigens (2011) 78:195-202 |
B*27:64N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | Tissue Antigens (2014) 83:184-189 |
B*27:65N | Point | Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 | Tissue Antigens (2014) 83:184-189 |
B*27:66N | Deletion | Exon 3, 547delT, in codon 159, causes frame shift and a premature stop at codon 189 | HLA (2017) 90:171-173 |
B*27:94N | Point | Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 | |
B*27:176N | Point | Exon 3, 598-600AAG>TAG, causes X176, a premature stop in codon 176 | |
B*27:212N | Point | Exon 4, 796-798CAG>TAG, causes Q242X, a premature stop at codon 24 | |
B*27:223N | Deletion | Exon 3, 408delG, in codon 112, causes frameshift and premature stop at codon 126 | |
B*27:225N | Point | Exon 2, 223-225TGG>TGA, causes W51X, a premature stop in codon 51 | HLA (2021) 97:232-233 |
B*27:243N | Point | Exon 2, 232-234CAG>TAG, causes X54, a premature stop at codon 54. | |
B*27:246N | Point | Exon 2, 256-258CAG>TAG, causes X65, a premature stop at codon 65 | |
B*27:254N | Deletion | Exon 3, 352-354delAC in codon 94, causes a frameshift and premature stop at codon 195 | |
B*27:261N | Insertion | Exon 2, 201(1-8)insCGAGTCCG in codon 43, causes a frameshift and premature stop at codon 55 | |
B*27:263N | Point | Exon 1, 41-43TGG>TGA, causes X-11, a premature stop at codon -11 | |
B*27:287N | Insertion | Exon 3, 548insGCCT in codon 159, causes a frameshift and premature stop at codon 196 | |
B*35:40N | Deletion | Exon 4, 807delA, in codon 245, causes frameshift and premature stop at codon 272 | Tissue Antigens (2002) 59:522-524 |
B*35:53N | Deletion | Exon 3, 473-477delCCGC, in codons 134-135, causes frameshift and premature stop at codon 155 | |
B*35:129N | Point | Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 | Tissue Antigens (2014) 83:184-189 |
B*35:130N | Point | Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27 | Tissue Antigens (2014) 83:184-189 |
B*35:134N | Point | Exon 4, 782-784TGG>TGA, causes W224X, a premature stop at 244 | |
B*35:145N | Insertion | Exon 3, 532-533insGCGG, in codon 154 causes a frameshift and premature stop codon at 197 | |
B*35:165N | Point | Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at 101 | |
B*35:173:01N | Point | Exon 2, 222-225TGG>TAG, causes W51X, premature stop at codon 51 | Tissue Antigens (2014) 83:184-189 |
B*35:173:02N | Point | Exon 2, 225G>A, causes W51X, a premature stop at codon 51 | |
B*35:216N | Point | Exon 2, 331-333 CAG-TAG, causes Q87X, a premature stop at codon 87 | |
B*35:381N | Point | Exon 3, 424-426TAC>TAA, causes X118, a premature stop in codon 118 | |
B*35:390N | Point | Exon 1, 40-42TGG>TAG, causes W-11X, a premature stop in codon -11 | |
B*35:427N | Insertion | Exon 3, 617-618insCG, in codon 183, causes a frameshift and premature stop at codon 190 | |
B*35:430N | Deletion | Exon 3, 518delC, in codon 149, causes a frameshift and premature stop at codon 156 | |
B*35:448N | Deletion | Exon 5, 687-693delCCTGGGC in codons 205-207, causes frameshift and premature stop at codon 213 | |
B*35:453N | Deletion | Exon 2, 286-287delCA in codon 72, causes frameshift and premature stop at codon 113 | |
B*35:456N | Point | Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 | |
B*35:459N | Point | Exon 4, 681-684TGG>TGA, causes W204X, a premature stop at codon 204 | |
B*35:461N | Point | Exon 3, 562-564, TGC>TGA, causes C164X, a premature stop in codon 164 | |
B*35:507N | Point | Exon 1, 1-3ATG>TTG, causes a non-synonymous change to the start codon, which may affect expression | |
B*35:508N | Point | Exon 2, 232C>T, in codon 54, causes Q54X, a premature stop in codon 54 | |
B*35:513N | Point | Exon 3, 571-573, TGG>TGA, causes X167, a premature stop at codon 167 | |
B*35:542N | Insertion | Exon 2, 133insC in codon 21, causes a frameshift and premature stop at codon 114 | HLA (2023) 101:507-512 |
B*35:551N | Deletion | Exon 2, 297-304delAGAGAGC in codons 75-77, causes X124, a frameshift and premature stop at codon 124 | |
B*35:574N | Point | Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which affects expression | HLA (2023) 101:676-677 |
B*35:597N | Insertion | Exon 1, 16insA in codon -19, causes a frameshift and premature stop at codon 114 | |
B*35:601N | Point | Exon 3, 424-426TAC>TAA, causes X118, a premature stop at codon 118 | |
B*35:609N | Insertion | Exon 3, 600insA in codon 176, causes a frameshift and premature stop at codon 196 | |
B*35:629N | Point | Exon 2, 292-294TAC>TAG, causes X74, a premature stop at codon 74 | |
B*35:636N | Point | Exon 2, 331-333CAG>TAG, causes X87, a premature stop at codon 87 | |
B*37:03N | Point | Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89 | |
B*37:30N | Point | Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133 | HLA (2019) 95:128-130 |
B*37:33N | Point | Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 | Tissue Antigens (2014) 83:184-189 |
B*37:42N | Deletion | Exon 2, 213delC, in codon 47, causes a premature stop at codon 52 | HLA (2017) 90:79-87 |
B*37:79N | Deletion | Exon 2, 286-287delCA, in codon 72, causes a frameshift and premature stop at codon 113. | |
B*37:82N | Deletion | Exon 2, 202-203delCC, in codon 43, causes a frameshift and premature stop at codon 113 | |
B*37:86N | Deletion | Exon 4, 701delC in codon 210, causes frameshift and premature stop at codon 216 | |
B*37:92N | Deletion | Exon 1, 46delG in codon -9, causes X-6, a frameshift and premature stop at codon -6. | |
B*37:109N | Deletion | Exon 4, 701delCCTGCGGAGATCACAC in codon 210, causes a frameshift and premature stop at codon 210 | HLA (2024) 104:- |
B*37:112N | Point | Exon 4, 856-858, CAG-TAG causes X262, a premature stop at codon 262 | |
B*38:34N | Point | Exon 2, 286-288CAG>TAG, causes Q72X, premature stop at codon 72 | Tissue Antigens (2014) 83:184-189 |
B*38:80N | Deletion | Exon 4, 757-767delGAGCTTGTGGA, in codons 229-232, causes frameshift and premature stop in codon 260 | |
B*38:83N | Deletion | Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop in codon 113 | |
B*38:103N | Point | Exon 3, 571-573TGG>TGA, causes X167, a premature stop at codon 167 | HLA (2024) 103:- |
B*38:113N | Deletion | Exon 3, 389delG in codon 106, causes a frameshift and premature stop at codon 126 | |
B*38:165N | Point | Exon 2, 331-333, CAG>TAG, causes X87, a premature stop at codon 87 | HLA (2020) 96:96-97 |
B*39:25N | Deletion | Exon 3, 403-404delGC, in codon 111, causes frameshift and premature stop at codon 113 | Human Immunology (2018) 79:763-772 |
B*39:40:01N | Point | Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | HLA (2020) 96:70-75 |
B*39:40:02N | Point | Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
B*39:87N | Point | Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 | HLA (2017) 90:171-173 |
B*39:95N | Point | Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | HLA (2016) 87:31-35 |
B*39:97N | Insertion | Exon 3, 604-605insGA, in codon 178, causes frameshift and premature stop at codon 190 | HLA (2016) 88:312-313 |
B*39:116N | Point | Exon 2, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
B*39:133N | Point | Exon 2, 251TGG>TAG, causes W60X, a premature stop in codon 60 | |
B*39:139N | Point | Exon 3, 469-471TGG>TGA, causes X133, a premature stop in codon 133 | |
B*39:142N | Deletion | Exon 2, 365delG, in codon 56, causes a frameshift and premature stop at codon 126. | |
B*39:146N | Insertion | Exon 2, 88insA, in codon 5, causes a frameshift and premature stop at codon 74 | |
B*39:147N | Insertion | Exon 2, 258insG, in codon 63, causes a frameshift and premature stop at codon 114 | |
B*39:157N | Deletion | Exon 2, 107delT, in codon 12, causes frameshift and premature stop at codon 34 | |
B*39:161N | Deletion | Exon 3, 390-391delCG, in codon 106-107, causes frameshift and premature stop at codon 113 | |
B*39:175N | Point | Exon 4, 664-666GAG>TAG, in codon 198, causes E198X, a premature stop in codon 198 | |
B*39:207N | Insertion | Exon 2, 259insG in codon 63, causes a frameshift and premature stop at codon 74 | |
B*39:214N | Point | Exon 3, 502-504CAG>TAG, causes X144, a premature stop at codon 144 | |
B*40:22N | Point | Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 | Tissue Antigens (2000) 55:378-380 |
B*40:118N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | Tissue Antigens (2014) 83:184-189 |
B*40:142N | Deletion | Exon 2, 253delG, in codon 60, causes frameshift and premature stop at codon 126 | |
B*40:144N | Point | Exon 4, 826-828GGA>TGA, causes G252X, a premature stop at codon 252 | Tissue Antigens (2011) 78:267-270 |
B*40:155:01N | Insertion | Exon 3, 593-594insCAGAA, in codon 174, causes frameshift and premature stop at codon 191 | Tissue Antigens (2011) 78:154-155 |
B*40:155:02N | Insertion | Exon 3, 593-594insCAGAA, in codon 174, causes frameshift and premature stop at codon 191 | HLA (2017) 90:171-173 |
B*40:216N | Deletion | Exon 3, 385delC, in codon 105, causes frameshift and a premature stop at codon 126 | |
B*40:256N | Deletion | Exon 2, 301-302delAG, in codon 77, causes frameshift and a premature stop at codon 113 | |
B*40:263N | Point | Exon 3, 580582AGA>TGA, causes R170X, a premature stop at codon 170 | HLA (2017) 90:171-173 |
B*40:265N | Deletion | Exon 2, 189-196delCGCCACGA, causes frameshift and a premature stop at codon 111 | HLA (2017) 90:171-173 |
B*40:286N | Point | Exon 3, 424-426TAC>TAG, causes Y118X , a premature stop at codon 118 | HLA (2017) 90:171-173 |
B*40:291N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | |
B*40:337N | Point | Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 | |
B*40:338N | Point | Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 | HLA (2018) 91:303-305 |
B*40:345N | Insertion | Exon 3, 508insC, in codon 146, causes frameshift and premature stop codon 196 | HLA (2017) 90:79-87 |
B*40:361N | Point | Exon 2, 331C>T, causes Q87X, premature stop at codon 87 | |
B*40:372N | Insertion | Exon 2, 327insA, in codon 85, causes frameshift and a premature stop in codon 85 | |
B*40:399N | Deletion | Exon 2, 113-116delGGCC, in codons 14 and 15, causes frameshift and premature stop in codon 33 | |
B*40:426N | Deletion | Exon 2, 321delC, in codon 83, causes a frameshift and premature stop at codon 126 | |
B*40:428N | Deletion | Exon 2, 279-282delCAAC, in codon 69-70, causes a frameshift and premature stop at codon 125 | |
B*40:438N | Deletion | Exon 2, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113 | |
B*40:481N | Deletion | Exon 2, 270delCTCCA in codon 66-68, causes frameshift and premature stop at codon 112 | |
B*40:483N | Point | Exon 4, 835-837CAG>TAG, causes X255, a premature stop at codon 255 | HLA (2022) 99:630-631 |
B*40:487N | Deletion | Exon 4, 643delC in codon 191, causes frameshift and premature stop at codon 201 | |
B*40:488N | Insertion | Exon 2, 160insG, in codon 30, cause a frameshift and premature stop in codon 114 | |
B*40:506N | Insertion | Exon 2, 81insCTCCTCCTCGCCCCCAGGCTCCCAC, causes a frameshift and premature stop in codon 122 | |
B*40:507N | Point | Exon 3, 469-471TGG>TGA, causes X133, a premature stop at codon 133 | |
B*40:508N | Deletion | Exon 2, 253delG, in codon 61, causes a frameshift and premature stop in codon 126 | HLA (2022) 99:619-621 |
B*40:510N | Deletion | Exon 2, 117delC in codon 15, causes X34, a frameshift and premature stop at codon 34 | HLA (2024) 104:- |
B*40:511N | Point | Exon 2, 337-339GAG>TAG, causes X89, a premature stop at codon 89 | HLA (2022) 99:619-621 |
B*40:514N | Point | Exon 2, 232>234CAG>TAG, causes X54, a premature stop at codon 54 | |
B*40:536N | Point | Exon 3, 571-573TGG>TGA, causes X167, a premature stop at codon 167 | HLA (2023) 102:524-525 |
B*40:540N | Point | Exon 3, 418-420TAC>TAA, causes X116, a premature stop at codon 116 |
HLA (2024) 104:- HLA (2024) 104:- |
B*40:545N | Point | Exon 4, 862-864GAG>TAG, causes E264X, a premature stop in codon 264 | |
B*40:563N | Point | Exon 3, 418-420TAC>TAA, causes X116, a premature stop at codon 116 | |
B*40:571N | Point | Exon 2, 127-129GAG>TAG, causes X19, a premature stop at codon 19 | HLA (2024) 104:- |
B*40:581N | Point | Exon 3, 373-375TGC>TAA, causes X101, a premature stop at codon 101 | |
B*40:590N | Deletion | Exon 4, 627delC in codon 185, causes a frameshift and premature stop at codon 189 | |
B*40:594N | Point | Exon 3, 562-564TGC>TGA, causes X164, a premature stop at codon 164 | |
B*41:45N | Insertion | Exon 2, 279-280insGAGACACAGATCTCCAAGACC, causes no frameshift but allele is shown to be non-expressed | HLA (2016) 88:50-51 |
B*44:19N | Deletion | Exon 1, 5delT, in codon -23, causes frameshift and a premature stop at codon -6 | Tissue Antigens (2000) 56:441-445 |
B*44:23:01:01N | Point | Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 |
European Journal of Immunogenetics (2003) 30:385-386 Tissue Antigens (2003) 61:20-48 |
B*44:23:01:02N | Point | Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | |
B*44:52N | Deletion | Exon 3, 492-505delTCAGATCACCCAGC, in codons 140-145, causes frameshift and premature stop at codon 191 | |
B*44:56N | Point | Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 | Tissue Antigens (2009) 73:607-609 |
B*44:58N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | Tissue Antigens (2009) 74:238-240 |
B*44:61N | Point | Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46 | |
B*44:108N | Point | Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 | Tissue Antigens (2012) 79:50-57 |
B*44:149N | Point | Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop at codon 96 | Tissue Antigens (2014) 83:184-189 |
B*44:171N | Point | Exon 2, 259-261GAG>TAG, causes E63X, a premature stop at codon 63 | Tissue Antigens (2014) 83:184-189 |
B*44:195N | Point | Exon 3, 571-573TCG>TAG, causes S167X, a premature stop at codon 167 | HLA (2016) 87:31-35 |
B*44:198N | Point | Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118 | HLA (2016) 87:31-35 |
B*44:217N | Point | Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 | |
B*44:237N | Deletion | Exon 2, 286-287delCA, in codon 72, causes frameshift and premature stop at codon 113 | HLA (2016) 88:126-127 |
B*44:267N | Insertion | Exon 4, 627insC, in codon 185, causes frameshift and premature stop at codon 196 | HLA (2018) 91:187-194 |
B*44:303N | Point | Exon 4, 721-723TGG>TAG, causes X217, a premature stop in codon 217. | |
B*44:306N | Point | Exon 1, 19-21CGA>TGA, causes X-18, a premature stop at codon -18 | |
B*44:309N | Insertion | Exon 1, 47insG, in codon -9, causes a frameshift and premature stop at codon 114. | |
B*44:310N | Insertion | Exon 4, 627insC, in codon 185, causes a frameshift and premature stop at codon 196. | |
B*44:314N | Insertion | Exon 3, 584insA, in codon 171, causes a frameshift and premature stop at codon 171 | |
B*44:328N | Point | Exon 2, 235-237GAG>TAG, causes X55, a premature stop in codon 55 | |
B*44:333N | Insertion | Exon 3, 515insA, in codon 148, causes a frameshift and premature stop in codon 196 | HLA (2023) 101:507-512 |
B*44:334N | Point | Exon 4, 679-681TGC>TGA, causes X203, a premature stop at codon 203 | |
B*44:341N | Insertion | Exon 4, 607-626insAAAGACACATGTGACCCCCC, in codon 185, causes frameshift and premature stop at codon 196 | |
B*44:345N | Deletion | Exon 2, 313-331delCTCCGCGGCTACTACAACC in codons 81-87, causes frameshift and premature stop at codon 120 | HLA (2020) 96:220-221 |
B*44:354N | Insertion | Exon 2, 146insT, causes a frameshift and premature stop at codon 114 | |
B*44:366N | Deletion | Exon 3, 433-438delAAGGA in codon 121, causes a frameshift and premature stop at codon 194 | |
B*44:370N | Insertion | Exon 3, 468insC in codon 133, causing a frameshift and premature stop at codon 196 | |
B*44:438N | Insertion | Exon 2, 319-320insAC in codon 83, causes frameshift and premature stop at codon 126 | |
B*44:448N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | |
B*44:449N | Deletion | Exon 2, 212delC in codon 47, causes frameshift and premature stop at codon 52 | |
B*44:466N | Point | Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression | |
B*44:512N | Deletion | Exon 3, 626delC in codon 185, causes frameshift and premature stop at codon 189 | |
B*44:523N | Deletion | Exon 4, 626delC, in codon 185, causes a frameshift and premature stop in codon 189 | |
B*44:544N | Point | Exon 3, 511TGG>TGA, causes W147X, a premature stop in codon 147 | HLA (2022) 99:631-633 |
B*45:28N | Deletion | Exon 2, 246delG, in codon 58, causes a frameshift and premature stop at codon 116 | |
B*46:07N | Point | Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | Tissue Antigens (2006) 68:518-520 |
B*46:15N | Point | Exon 4,736-738GAG>TAG, causes E222X, a premature stop at codon 222 | |
B*46:41N | Deletion | Exon 2, 268-280delAGCCGAGGCACA, in codon 66-70, causes a frame shift and premature stop codon at 72 | HLA (2020) 95:212-213 |
B*46:55N | Point | Exon 3, 469-471TGG>TAG, causes W133X, a premature stop codon at 133 | HLA (2017) 90:171-173 |
B*46:79N | Deletion | Exon 2, 269delA in codon 66, causes frameshift and premature stop at codon 76 | |
B*46:95N | Point | Exon 1, 1-3ATG>ACG, causes mutation in the start codon, which may affect expression | HLA (2023) 101:679-680 |
B*46:98N | Insertion | Exon 3, 460insC in codon 130, cause a frameshift and premature stop at codon 152 | |
B*48:59N | Point | Exon 3, 494-496CAG>TAG, causes X140, a premature stop at codon 140 | |
B*49:19N | Point | Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133 | |
B*49:60N | Deletion | Exon 2, 217delG, in codon 49, causes frameshift and premature stop at codon 52 | |
B*50:27N | Deletion | Exon 4, 830delGA in codon 253, causing a frameshift and premature stop at codon 263 | |
B*50:72N | Point | Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop in codon 65 | |
B*51:11N | Insertion | Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | Tissue Antigens (2001) 57:369-372 |
B*51:27N | Point | Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144 | Tissue Antigens (2002) 60:262-265 |
B*51:41N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
B*51:44N | Point | Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon 65 | |
B*51:98N | Point | Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 | Tissue Antigens (2014) 83:184-189 |
B*51:110N | Point | Exon 2, 325-327TAC>TAG, causes Y85X, a premature stop codon 85 | Tissue Antigens (2014) 83:184-189 |
B*51:118N | Deletion | Exon 2, 264-265delAC, in codons 64-65, causes frameshift and premature stop at codon 113 | |
B*51:149N | Deletion | Exon 3, 611delA, in codon 180, causes frame shift and premature stop codon at codon 189 | |
B*51:178N | Point | Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 | HLA (2016) 87:31-35 |
B*51:184N | Point | Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32 | |
B*51:235N | Point | Exon 3, 511-513TGG>TAG, causes X147, a premature stop in codon | |
B*51:245N | Point | Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65 | |
B*51:256N | Deletion | Exon 4, 743-744delAA, in codon 224, causes a frameshift and premature stop in codon 228 | |
B*51:264N | Deletion | Exon 4, 713delC, in codon 216, causes a frameshift and premature stop at codon 215. | |
B*51:273N | Deletion | Exon 3, 380delT, in codon 103, causes a frameshift and premature stop at codon 126 | |
B*51:287N | Deletion | Exon 3, 523delC in codon 151, causes frameshift and premature stop at codon 156 | |
B*51:306N | Deletion | Exon 3, 393delG, in codon 107, causes a frameshift and premature stop in codon 126 | |
B*51:313N | Insertion | Exon 3, 507insC in codon 146, causes frameshift and premature stop at codon 152 | |
B*51:318N | Deletion | Exon 2, 300delGA, causes a frameshift and premature stop in codon 113. | |
B*51:325N | Deletion | Exon 3, 474delC in codon 134, causes frameshift and premature stop at codon 156 | |
B*51:344N | Point | Exon 2, 91-93TAT>TAG, causes Y7X, a premature stop in codon 7 | |
B*51:357N | Deletion | Exon 2, 127delG, in codon 19, causes a frameshift and premature stop at codon 34 | |
B*51:361N | Deletion | Exon 4, 688delC, in codon 206, causes a frameshift and premature stop in codon 215 | |
B*51:365N | Point | Exon 4, 724-726CAG>TAG, causes X218, a premature stop at codon 218 | |
B*51:377N | Insertion | Exon 2, 114insTCCCG, causes a frameshift and premature stop in codon 36 | HLA (2024) 104:- |
B*51:387N | Point | Exon 3, 683-685TGG>TGA, causes X203, a premature stop at codon 203 | |
B*51:391N | Point | Exon 3, 455-457GAG>TAG, causes X127, a premature stop at codon 127 | |
B*51:409N | Point | Exon 3, 547-549TAC>TAG, causes X159, a premature stop at codon 159 | HLA (2024) 104:- |
B*51:415N | Deletion | Exon 4, 624delC in codon 184, causes a frameshift and premature stop at codon 189 | |
B*52:49N | Point | Exon 3, 601-603GAG>TAG, in codon 177, causes E177X, a premature stop at codon 177 | HLA (2021) 98:553-555 |
B*52:89N | Deletion | Exon 2, 286-287delCA in codon 72, causes frameshift and premature stop at codon 113 | |
B*52:94N | Deletion | Exon 4, 626delC, in codon 185, causes frameshift and premature stop at codon 189 | |
B*52:96N | Point | Exon 3, 493-495, CAG>TAG, causes X141, a premature stop at codon 141 | |
B*52:103N | Point | Exon 4, 892-894, TGG>TAG causes X274, a premature stop at codon 274 | |
B*52:110N | Point | Exon 3, 454-456GAG>TAG, causes X128, a premature stop at codon 128 | HLA (2023) 101:58-59 |
B*52:115N | Point | Exon 3, 418-420TAC>TAA, causes X116, a premature stop at codon 116 | |
B*52:120N | Point | Exon 2, 337-339GAG>TAG, causes X89, a premature stop at codon 89 | |
B*52:124N | Insertion | Exon 4, 818insAGCTGAG in codon 249, causes a frameshift and premature stop at codon 266 | |
B*53:48N | Point | Exon 3, 426C>A, causes Y118X, a premature stop at codon 118 | |
B*53:80N | Deletion | Exon 3, 414delA in codon 114, causes a frameshift and premature stop at codon 126 | HLA (2024) 104:- |
B*54:05N | Deletion | Exon 2, 212-232delCGCGGGCGCCGTGGATAGAGC, in codons 47-54, causes no frameshift but deletion of 7 amino acids | |
B*54:08N | Point | Exon 3, 553-554GAG>TAG, causes E161X, a premature stop at codon 161 | Tissue Antigens (2006) 68:182- |
B*54:49N | Deletion | Exon 1, 14delG in codon 20, causes a frameshift and premature stop at codon -6 | |
B*55:55N | Point | Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159 | Tissue Antigens (2014) 83:184-189 |
B*55:83N | Point | Exon 4, 799A>T, causes K243X, a premature stop at codon 243 | HLA (2017) 89:119-120 |
B*55:89N | Insertion | Exon 4, 600insA in codon 176, causes frameshift and premature stop in codon 196 | |
B*55:97N | Deletion | Exon 1, 41delC, in codon -9, causes a frameshift and premature stop in codon -6. | |
B*55:117N | Deletion | Exon 4, 643delC, in codon 191, causes a frameshift and premature stop in codon 201 | HLA (2021) 98:480-481 |
B*55:118N | Deletion | Exon 2, 268-273delATCTA, in codon 66, causes a frameshift and premature stop at codon 72 | |
B*55:125N | Point | Exon 1, 1-3ATG>ATA, causes mutation in the start codon, which may affect expression | |
B*55:132N | Deletion | Exon 4, 867delG in codon 265, causes X272, a premature stop at codon 272 | |
B*56:19N | Point | Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
B*56:28N | Point | Exon 2, 247-249TGG>TGA, causes W59X, a premature stop at codon 59 | |
B*56:38N | Point | Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32 | Tissue Antigens (2014) 83:184-189 |
B*56:77N | Point | Exon 3, 571-573, TGG>TGA, causes X167, a premature stop at codon 167 | |
B*57:28N | Point | Exon 3, 418-420TAC>TAG, causes Y116X, a premature stop at codon 116 | International Journal of Immunogenetics (2010) 37:299-300 |
B*57:79N | Deletion | Exon 4, 876delG, in codon 268, causes frameshift and premature stop at codon 272 | |
B*57:122N | Point | Exon 3, 513-515TGG>TGA, causes W147X, a premature stop at codon 147 | |
B*57:130N | Deletion | Exon 4, 863delA in codon 264, causes frameshift and premature stop at codon 272 | |
B*57:139N | Insertion | Exon 3, 617-618inCG in codon 183, causes frameshift and premature stop at codon 190 | |
B*57:142N | Point | Exon 3, 469-471TGG>TAG, in codon 133, causes W133X, a premature stop in codon 133 | HLA (2021) 98:380-381 |
B*57:143N | Point | Exon 3, 502-504CAG>TAG, causes X144, a premature stop at codon 144 | |
B*57:162N | Insertion | Exon 2, 81insAC in codon 3, causes a frameshift and premature stop at codon 6 | |
B*57:181N | Insertion | Exon 3, 440insT in codon 123, causes a frameshift and premature stop at codon 196 | |
B*58:10N | Deletion | Exon 3, 366delG, in codon 98, causes frameshift and premature stop at codon 126 | |
B*58:17N | Deletion | Exon 3, 311delA, in codon 80, causes frameshift and premature stop at codon 126 | Tissue Antigens (2009) 73:364-372 |
B*58:31N | Deletion | Exon 4, 872-894delCGAAGCCCCTCACCCTGAGATGG, causes frameshift and premature stop at codon 300 | HLA (2017) 90:171-173 |
B*58:39N | Point | Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46 | Tissue Antigens (2014) 83:184-189 |
B*58:72N | Insertion | Exon 3, 508insC, in codon 146, causes frameshift and premature stop at codon 196 | HLA (2016) 87:54-55 |
B*58:93N | Point | Exon 3, 367-369TAT>TAA, causes Y99X, a premature stop in codon 99 | |
B*58:94N | Point | Exon 3, 571-573TGG>TGA, causes X167, a premature stop in codon 167 | |
B*58:128N | Insertion | Exon 2, 320insG in codon 83, causes frameshift and premature stop at codon 114. | |
B*58:130N | Insertion | Exon 4, 626insC in codon 185, causes frameshift and premature stop at codon 196 | |
B*58:133N | Deletion | Exon 4, 759delG in codon 229, causes a frameshift and premature stop in codon 272 | HLA (2023) 102:343-347 |
B*58:144N | Point | Exon 2, 223-225TGG>TGA, causes X50, a premature stop at codon 50 | HLA (2024) 103:- |
B*59:10N | Deletion | Exon 3, 506delG, in codons 145, causes frameshift and premature stop at codon 156 | |
B*81:04N | Point | Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 | Tissue Antigens (2009) 73:364-372 |
C*01:37N | Point | Exon 3, 361-363TGG>TGA, causes W97X, a premature stop at codon 97 | |
C*01:56N | Point | Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 | |
C*01:69N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | Tissue Antigens (2014) 83:184-189 |
C*01:86N | Deletion | Exon 3, 421delG, in codon 117, causes frameshift and premature stop at codon 126 | HLA (2017) 90:171-173 |
C*01:89N | Point | Exon 4, 841-843TAC>TAG, causes Y257X, a premature stop at codon 257 | HLA (2017) 90:171-173 |
C*01:98N | Deletion | Exon 2, 285-286delAC, in codons 72-73, causes frameshift and premature stop at codon 73 | |
C*01:109N | Point | Exon 4, 682-684TGG>TAG, in codon 204, causes S204X, a premature stop at codon 204 | HLA (2017) 89:252-253 |
C*01:111N | Point | Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 | |
C*01:117N | Insertion | Exon 2, 203-204insA, in codon 44, causes frameshift and premature stop at codon 74 | HLA (2018) 92:304-309 |
C*01:137N | Deletion | Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113 | HLA (2018) 91:187-194 |
C*01:143N | Point | Exon 3, 585C>A, causes Y171X, a premature stop at codon 171 | HLA (2023) 102:760-762 |
C*01:145:01N | Point | Exon 3, 420C>A, causes Y116X, a premature stop at codon 116 | |
C*01:145:02N | Point | Exon 3, 418-420, TAA>TAG, causes X116, a premature stop at codon 116 | |
C*01:171N | Deletion | Exon 2, 319delG, in codon 83, causes a frameshift and premature stop at codon 126 | |
C*01:181N | Point | Exon 4, 829-831GAA>TAA causes E253X, a premature stop at codon 25 | |
C*01:211N | Deletion | Exon 2, 240delG in codon 56, causes frameshift and premature stop at codon 76 | |
C*01:222N | Deletion | Exon 3, 525delT, causes a frameshift and premature stop in codon 189. | |
C*01:224N | Point | Exon 3, 411T>A, in codon 113, causes Y113X, a premature stop in codon 113 | HLA (2022) 99:640-641 |
C*01:228N | Deletion | Exon 2, 265-267delCA, causes a frameshift and premature stop in codon 73 | |
C*01:229N | Insertion | Exon 2, 294insTGAC, causes a frameshift and premature stop in codon 75 | |
C*01:231N | Deletion | Exon 3, 402-425delCCGCGGGTATGACCAGTACGCCT in codon 110, causes a frameshift and premature stop at codon 144. | |
C*01:257N | Point | Exon 4, 728-730TGG>TAG, causes X219, a premature stop at codon 219 | |
C*01:265N | Point | Exon 2, 166-168CAG>TAG, causes X32, a premature stop at codon 32 | |
C*01:266N | Insertion | Exon 3, 454insC in codon 128, causes a frameshift and premature stop at codon 152 | |
C*01:275N | Point | Exon 2, 271-273TAC>TAA, causes X67, a premature stop at codon 67 | |
C*01:279N | Point | Exon 4, 856-858CAG>TAG, causes X262, a premature stop at codon 262 | |
C*02:38:01N | Point | Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 |
Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 |
C*02:38:02N | Point | Exon 3, 367-369TAC>TAG, causes X99, a premature stop at codon 99 | |
C*02:52N | Point | Exon 2, 151-153TAC>TAA, causes Y27X, premature stop at codon 27 | Tissue Antigens (2014) 83:184-189 |
C*02:92N | Deletion | Exon 3, 382delG, in codon 104, causes frameshift and premature stop at codon 126 | HLA (2017) 90:79-87 |
C*02:105N | Insertion | Exon 2, 224-230insTCGCCGT, in codon 51, causes frameshift and premature stop at codon 76 | |
C*02:121N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | |
C*02:135N | Deletion | Exon 3, 538-539delCG, in codon 154, causes frameshift and premature stop in codon 195 | HLA (2018) 91:538-539 |
C*02:150N | Point | Exon 4, 742-744CAA>TAA, causes X224, a premature stop in codon 224 | |
C*02:165N | Deletion | Exon 2, 265-266delCA, in codon 65, causes a frameshift and premature stop at codon 73 | |
C*02:169N | Insertion | Exon 4, 696insG, in codon 205, causes frameshift and premature stop in codon 31 | |
C*02:192N | Point | Exon 3, 571-573, TGG>TAG, causes X167, a premature stop at codon 167 | |
C*02:193N | Point | Exon 4, 682-684TGG>TAG, causesW 204X, a premature stop in codon 204 | |
C*02:216N | Point | Exon 3, 454-456GAG>TAG, causes X128, a premature stop at codon 128 | HLA (2023) 101:46-47 |
C*02:218N | Insertion | Exon 1, 28insC in codon -15, causes a frameshift and premature stop at codon 74 | |
C*02:223N | Point | Exon 3, 409-411TAT>TAA, causes X113, a premature stop at codon 113 | |
C*02:227N | Deletion | Exon 2, 185delG in codon 38, causes a frameshift and premature stop at codon 76 | |
C*02:253N | Point | Exon 3, 171-173TAC>TAA, causes X171, a premature stop at codon 171 | |
C*03:03:01:50N | Point | Intron 2, 718A>G, causes a mutation in the splice site preceding exon 3 | |
C*03:03:01:52N | Point | Intron 1, 203G>A, affecting the splice site for intron 2 | HLA (2022) 99:50-51 |
C*03:20N | Point | Exon 1, 19-21CGA>TGA, causes R-18X, a premature stop at codon -18 | |
C*03:23N | Point | Exon 3, 406G>A, causes incorrect splicing and the deletion of 64bp, resulting in a frameshift and premature stop codon |
HLA (2018) 92:304-309 HLA (2020) 95:555-560 |
C*03:121N | Point | Exon 3, 511-513TGG>TGA, causes W147X, premature stop at codon 147 | |
C*03:189N | Point | Exon 2, 151-153TAC>TAG, causes Y27X, a premature stop at codon 27 | |
C*03:201N | Point | Exon 3, 583-585TAC>TAG, causes Y171X, a premature stop at codon 171 | HLA (2017) 90:171-173 |
C*03:208N | Point | Exon 2, 271-273TAC>TAA, causes Y67X, a premature stop at codon 67 | HLA (2017) 90:171-173 |
C*03:224N | Point | Exon 4, 727-729TGG>TAG, causes W219X, a premature stop at codon 219 | HLA (2017) 90:171-173 |
C*03:229N | Point | Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 | HLA (2017) 90:171-173 |
C*03:265N | Point | Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118 | |
C*03:277N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
C*03:316N | Deletion | Exon 2, 286-287delCA, causes frameshift and premature stop at codon 73 | HLA (2019) 95:128-130 |
C*03:318N | Point | Exon 3, 418-420TAC>TAA, causes Y116X, a premature stop at codon 116 |
HLA (2017) 90:79-87 HLA (2017) 90:79-87 |
C*03:323N | Point | Exon 2, 280-282CAG>TAG, causes Q70X, a premature stop at codon 70 | |
C*03:363N | Point | Exon 2, 225G>A, causes W51X, a premature stop at codon 51 | |
C*03:366N | Deletion | Exon 4, 668-678delCCACCCTGAGG, in codons 199-202, causes frameshift and premature stop at codon 225 | HLA (2018) 91:187-194 |
C*03:377N | Deletion | Exon 2, 299-302delTGAG, in codons 76-77, causes frameshift and premature stop in codon 125 | |
C*03:380N | Point | Exon 4, 895-898GAG>TAG, causes E275X, a premature stop in codon 275 | |
C*03:391N | Insertion | Exon 2, 370insT, in codon 100, causes a frameshift and premature stop in codon 114 | |
C*03:392N | Deletion | Exon 2, 236delA, in codon 55, causing a frameshift and a premature stop in codon 76 | |
C*03:396:01N | Point | Exon 2, 325-327TAC>TAG, causes X85, a premature stop in codon 85 | |
C*03:396:02N | Point | Exon 2, 325-327TAG>TAA, causes X85, a premature stop in codon 85 | |
C*03:421N | Point | Exon 1, 43-45GGA>TGA, causes X-10, a premature stop in codon -10 | |
C*03:424N | Point | Exon 4, 721-723TGG>TAG, causes X217, a premature stop in codon 217 | |
C*03:432N | Point | Exon 4, 721-723TGG>TGA, causes X217, a premature stop in codon 217 | |
C*03:444N | Deletion | Exon 3, 387delC, in codon 105, causes a frameshift and premature stop at codon 126 | |
C*03:445N | Deletion | Exon 3, 586delC, in codon 172, causes a frameshift and premature stop at codon 172 | |
C*03:446N | Insertion | Exon 3, 388insC, in codon 106, causes a frameshift and premature stop at codon 114. | |
C*03:447N | Deletion | Exon 3, 466delT, in codon 132, causes a frameshift and premature stop at codon 156 | |
C*03:449N | Insertion | Exon 2, 80insC, in codon 3, causes a frameshift and premature stop at codon 74 | |
C*03:462N | Insertion | Exon 3, 394insA, in codon 108, causes a frameshift and premature stop at codon 114. | |
C*03:463N | Deletion | Exon 3, 421-422delGC, in codon 117, causes frameshift and premature stop in codon 151 | |
C*03:470N | Point | Exon 1, 19C>T, in codon -18, causes CGA>TGA, a premature stop at codon -18 | |
C*03:508N | Deletion | Exon 2, 145delG in codon 25, causes frameshift and premature stop at codon 76 | |
C*03:509N | Deletion | Exon 2, 149delG in codon 26, causes frameshift and premature stop at codon 76 | |
C*03:510N | Point | Exon 1, 127-129, GAG>TAG, causes X19, a premature stop at codon 19 | |
C*03:511N | Insertion | Exon 2, 241insG in codon 241, causes frameshift and premature stop at codon 74 | |
C*03:531N | Deletion | Exon 2, 265delCA, in codon 65, causes a frameshift and premature stop in codon 73 | |
C*03:560N | Deletion | Exon 4, 679delT in codon 203, causes a frameshift and premature stop at codon 215 | HLA (2022) 99:392-394 |
C*03:571N | Insertion | Exon 3, 430insT, in codon 120, causes a frameshift and premature stop in codon 152 | HLA (2023) 102:343-347 |
C*03:618N | Point | Exon 1, 67-69TGG>TGA, causes W-2X, a premature stop in codon -2 | HLA (2023) 101:682-683 |
C*03:619N | Insertion | Exon 2, 239insG in codon 55, causes a frameshift and premature stop at codon 74 | |
C*03:625N | Deletion | Exon 3, 351delCA in codon 94, causes a frameshift and premature stop at codon 113 | |
C*03:628N | Point | Exon 2, 97-99TAC>TAA, causes X9, a premature stop at codon 9 | |
C*03:635N | Point | Exon 3, 358-360CAG>TAG, causes X96, a premature stop at codon 96 | |
C*03:636N | Point | Exon 4, 782-784TGG>TGA, causes W244X, a premature stop in codon 244 | |
C*03:643N | Point | Exon 3, 359-361 CAG>TAG, causes X96, a premature stop at codon 96 | |
C*03:653N | Deletion | Exon 3, 469delC in codon 132, causes a frameshift and premature stop at codon 156 | |
C*03:659N | Deletion | Exon 3, 435delAGGA in codon 121, causes a frameshift and premature stop at codon 125 | |
C*03:662N | Deletion | Exon 2, 134delC in codon 21, causes a frameshift and premature stop at codon 76 | |
C*03:680N | Point | Exon 2, 325-327TAC>TAA, causes X85, a premature stop at codon 85 | |
C*03:697N | Point | Exon 2, 91-93TAT>TAG, causes X7, a premature stop at codon 7 | |
C*04:61N | Deletion | Exon 7, 1095delA, in codon 341, causes frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 32 amino acids | Tissue Antigens (2014) 83:184-189 |
C*04:88N | Point | Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 | Tissue Antigens (2014) 83:184-189 |
C*04:93N | Point | Exon 3, 373-375TGC>TGA, causes C101X, premature stop at codon 101 | Tissue Antigens (2014) 83:184-189 |
C*04:95N | Point | Exon 3, 547-549TAC>TAA, causes W159X, premature stop at codon 159 | Tissue Antigens (2014) 83:184-189 |
C*04:105N | Point | Exon 2, 247-249TAT>TAG, causes Y59X, a premature stop at codon 59 |
Tissue Antigens (2014) 83:184-189 HLA (2024) 104:- |
C*04:115N | Point | Exon 2, 49-51GAG>TAG, causes A49X, a premature stop at codon 49 | Tissue Antigens (2014) 83:184-189 |
C*04:123N | Point | Exon 2, 115-117CAG>TAG, causes Q115X, a premature stop at codon 115 | |
C*04:170N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | |
C*04:173N | Point | Exon 2, 268-270AAG>TAG, causes K66X, a premature stop at codon 66 | |
C*04:191N | Point | Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 | |
C*04:203N | Point | Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147 | |
C*04:205N | Point | Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 | |
C*04:215N | Point | Exon 2, 271-273TAC>TAG, causes Y67X, a premature stop at codon 67 | |
C*04:217N | Deletion | Exon 2, 208delG, in codon 46 causes frameshift and premature stop at codon 76 | |
C*04:225N | Point | Exon 2, 265-267CAG>TAG, causes E65X, a premature stop at codon 65 | |
C*04:233N | Point | Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 | |
C*04:234N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | HLA (2017) 90:79-87 |
C*04:236N | Deletion | Exon 2, 218delA, in codon 49 causes frameshift and premature stop at codon 76 | HLA (2017) 90:79-87 |
C*04:253N | Point | Exon 3, 532-534GAG>TAG causes R154X, a premature stop at codon 154 | |
C*04:255N | Insertion | Exon 2, 194-195insC, in codon 41, causes frameshift and premature stop at codon 74 | |
C*04:279N | Point | Exon 2, 295C>T, causes R75X, a premature stop at codon 75 | HLA (2023) 101:293-294 |
C*04:300N | Point | Exon 2, 271-273TAC>TAG, causes Y67X, a premature stop at codon 67 | |
C*04:305N | Deletion | Exon 3, 496delA, in codon 142, causes a frameshift and a premature stop in codon 189 | |
C*04:309N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | |
C*04:349N | Insertion | Exon 3, 518-519insCG, in codon 150, causes a frameshift and premature stop at codon 190 | |
C*04:350N | Deletion | Exon 2, 267-274delGAAGTACA, in codons 65-68, causes a frameshift and premature stop at codon 71 | |
C*04:362N | Point | Exon 2, 151-153TAC>TAG, causes X27, a premature stop at codon 27 | |
C*04:364N | Insertion | Exon 2, 267insA, in codon 65, causes a frameshift and premature stop at codon 74 | |
C*04:365N | Deletion | Exon 2, 331delC, in codon 87, causes a frameshift and premature stop at codon 126 | |
C*04:369N | Deletion | Exon 3, 568delG, in codon 166, causes a frameshift and premature stop at codon 189. | |
C*04:371N | Point | Exon 2, 112-114TGG>TGA, causes W14X, a premature stop in codon 14 | |
C*04:374N | Deletion | Exon 3, 365delT, in codon 98, causes a frameshift and premature stop in codon 126 | |
C*04:377N | Deletion | Exon 2, 127delG in codon 19, causes frameshift and premature stop at codon 76 | |
C*04:385N | Deletion | Exon 3, 393delG in codon 107, causes frameshift and premature stop at codon 126 | |
C*04:396N | Insertion | Exon 2, 239insG, in codon 56, causes a framshift and premature stop at codon 74 | |
C*04:410N | Point | Exon 2, 274-276, AAG>TAG, causes X68, a premature stop at codon 68 | |
C*04:411N | Point | Exon 4, 727-729, TGG>TAG, causes X219, a premature stop at codon 219 | |
C*04:417N | Deletion | Exon 2, 159delC in codon 29, causes frameshift and premature stop at codon 76 | |
C*04:436N | Point | Exon 2, 250-252TGG>TAG, causes X60, a premature stop at codon 60 | |
C*04:452N | Point | Exon 4, 243-245TGG>TAG, causes W244X, a premature stop in codon 244 | |
C*04:486N | Insertion | Exon 2, 151insT in codon 27, causes a frameshift and premature stop at codon 74 | |
C*04:498N | Point | Exon 3, 493-495CAG>TAG, causes X141, a premature stop at codon 141 | |
C*04:509N | Deletion | Exon 3, 353delAC in codon 94, causes a frameshift and premature stop at codon 113 | |
C*04:515N | Deletion | Exon 3, 591delG in codon 173, causes a frameshift and premature stop at codon 189 | |
C*05:07N | Deletion | Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113 | HLA (2017) 90:79-87 |
C*05:48N | Point | Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32 | Tissue Antigens (2014) 83:184-189 |
C*05:91N | Point | Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89 | |
C*05:92N | Point | Exon 2, 175-177CAG>TAG, causes Q35X, a premature stop at codon 35 | HLA (2017) 90:79-87 |
C*05:99N | Deletion | Exon 3, 384delG, in codon 104, causes frameshift and premature stop at codon 126 | Tissue Antigens (2014) 84:420-421 |
C*05:113N | Deletion | Exon 2, 93-94delTT, in codons 7-8, causes frameshift and premature stop at codon 73 | |
C*05:128N | Deletion | Exon 3, 461-474delTGCGCTCCTGGACC, in codons 130-134, causes frameshift and premature stop at codon 147 | HLA (2018) 92:304-309 |
C*05:153N | Point | Exon 1, 61G>T, causes E-4X, premature stop at codon -4 | |
C*05:154N | Point | Exon 3, 514G>T, causes E148X, premature stop at codon 148 | |
C*05:169N | Point | Exon 2, 244-246GAG>TAG, causes X58, a premature stop in codon 58 | |
C*05:175N | Point | Exon 3, 358-360CAG>TAG, causes X94, a premature stop in codon 96 | HLA (2023) 101:507-512 |
C*05:180N | Point | Exon 3, 424-426TAC>TAG, causes X118, a premature stop in codon 118 | |
C*05:208N | Insertion | Exon 3, 507insC, in codon 146, causes a frameshift and premature stop at codon 152 | |
C*05:213N | Insertion | Exon 3, 466insT, in codon 132, causes a frameshift and premature stop at codon 152 | |
C*05:239N | Point | Exon 4, 682-684, TGG>TAG, causes W204X, a premature stop at codon 204. | |
C*05:244N | Point | Exon 3, 511TGG>TAG, causes W147X, a premature stop in codon 147 | |
C*05:251N | Insertion | Exon 3, 548insTA in codon 159, causes frameshift and premature stop at codon 190 | |
C*05:253N | Point | Exon 2, 280-282CAG>TAG, in codon 70, causes Q70X, a premature stop in codon 70 | |
C*05:257N | Deletion | Exon 3, 563delG in codon 164, causes frameshift and premature stop at codon 189 | |
C*05:259N | Point | Exon 3, 469-471TGG>TAG, causes W133X, a premature stop in codon 133 | |
C*05:260N | Point | Exon 4, 697-698TAC>TAA, causes Y209X, a premature stop in codon 209 | |
C*05:263N | Deletion | Exon 2, 246delG, in codon 58, causes a frameshift and premature stop in codon 76 | |
C*05:264N | Point | Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop in codon 180 | |
C*05:270N | Point | Exon 3, 415C>T, in codon 115, causes Q115X, a premature stop in codon 115 | |
C*05:271N | Point | Exon 3, 493C>T, in codon 141, causes Q141X, a premature stop in codon 141 | |
C*05:278N | Point | Exon 4, 802-804TGG>TGA, causes X244, a premature stop at codon 244 | HLA (2023) 102:369-370 |
C*05:291N | Point | Exon 4, 875-877GAG>TAG, causes X267, a premature stop at codon 267 | |
C*05:292N | Deletion | Exon 3, 385delG in codon 104, causes a frameshift and premature stop at codon 126 | HLA (2024) 103:- |
C*05:296N | Point | Exon 3, 547-549TAC>TAG, causes X159, a premature stop at codon 159 | |
C*05:297N | Deletion | Exon 2, 324delA in codon 84, causes a frameshift and premature stop at codon 126 | |
C*05:303N | Deletion | Exon 2, 268delGA in codon 65, causes a frameshift and premature stop at codon 75 | |
C*06:16N | Deletion | Exon 3, 499-500delAC, in codon 143, causes a frameshift and premature stop at codon 151 |
Tissue Antigens (2007) 70:441-442 HLA (2017) 90:79-87 |
C*06:46N | Point | Exon 4, 742-744CAA>TAA, causes Q224X, a premature stop at codon 224 | |
C*06:49N | Point | Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101 | Tissue Antigens (2014) 83:184-189 |
C*06:79N | Point | Exon 3, 538-540TGG>TGA, causes R156X, a premature stop at codon 156 | |
C*06:116N | Deletion | Exon 3, 615-619delCGCGG, in codon 181, causes a premature stop at codon 194 | HLA (2017) 90:171-173 |
C*06:128N | Point | Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 | |
C*06:134N | Point | Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65 | |
C*06:152N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | |
C*06:171:01:01N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | HLA (2017) 90:79-87 |
C*06:171:01:02N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | |
C*06:175N | Point | Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147 | |
C*06:208N | Point | Exon 3, 585C>G, causes Y171X, a premature stop at codon 171 | |
C*06:211:01:01N | Point | Exon 4, 894G>A, causes W274X, a premature stop at codon 274 | HLA (2019) 94:347-359 |
C*06:211:01:02N | Point | Exon 4, 894G>A, causes W274X, a premature stop at codon 274 | |
C*06:215N | Deletion | Exon 3, 568delG, in codon 166, causes frameshift and premature stop in codon 189 | |
C*06:220N | Insertion | Exon 3, 572insT, in codon 167, causes a frameshift and a premature stop in codon 196 | |
C*06:257N | Insertion | Exon 3, 520insG, in codon 150, causes a frameshift and premature stop at codon 189 | |
C*06:259N | Insertion | Exon 2, 164insC, in codon 31, causes a frameshift and premature stop at codon 74 | |
C*06:263N | Deletion | Exon 3, 488delC, in codon 139, causes a frameshift and a premature stop in codon 189 | |
C*06:267N | Insertion | Exon 3, 559-560insGC, in codon 163, causes frameshift and premature stop at codon 190 | |
C*06:281N | Deletion | Exon 2, 269delA, in codon 66, causes frameshift and premature stop at codon 76. | |
C*06:301N | Point | Exon 3, 468-470, TGG>TAG, causes X133, a premature stop at codon 133 | |
C*06:309N | Point | Exon 2, 229-231GAG>TAG, causes E53X, a premature stop in codon 53 | |
C*06:316N | Point | Exon 3, 598-601AAG>TAG, causes K176X, a premature stop in codon 176 | |
C*06:323N | Point | Exon 3, 562-564TGC>TGA, in codon 164, causes C164X, a premature stop in codon 164 | |
C*06:338N | Insertion | Exon 3, 609insG in codon 180, causes frameshift and premature stop at codon 196 | |
C*06:347N | Deletion | Exon 3, 395delG, in codon 108, causes a frameshift and premature stop in codon 126 | |
C*06:350N | Deletion | Exon 3, 418delT in codon116, causes a frameshift and premature stop at codon 126 | |
C*06:353N | Insertion | Exon 2, 247insGAGT in codon 59, causes a frameshift and premature stop at codon 59 | |
C*06:357N | Point | Exon 2, 73-75TGC>TGA, causes X1, a premature stop at codon 1 | |
C*06:359N | Insertion | Exon 4, 843insA in codon 257, causes a frameshift and premature stop at codon 257 | |
C*06:362N | Point | Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop in codon 180 | |
C*06:373N | Point | Exon 2, 331-333CAG>TAG, cases X87, a premature stop at codon 87 | |
C*06:376N | Insertion | Exon 3, 538insC in codon 156, causes a frameshift and premature stop at codon 190 | HLA (2024) 103:- |
C*06:383N | Point | Exon 3, 571-573TGG>TAG, causes X167, a premature stop at codon 167 | |
C*07:02:01:17N | Point | Intron 3, g710T>A, causes incorrect splicing and the deletion of 110bp, resulting in a frameshift and premature stop codon | HLA (2018) 92:56-57 |
C*07:32N | Insertion | Exon 3, 560-561insCGCAGAT, in codon 163, causes frameshift and premature stop at codon 198 | HLA (2017) 90:79-87 |
C*07:33N | Deletion | Exon 2, 92delA, in codon 7, causes frameshift and premature stop at codon 76 | Tissue Antigens (2008) 71:560-563 |
C*07:55N | Point | Exon 3, 409-411TAT>TAG, causes Y113X, a premature stop at codon 113 |
Tissue Antigens (2012) 79:139- Human Immunology (2018) 79:763-772 |
C*07:61N | Point | Exon 2, 280-282CAG>TAG, causes Q70X, a premature stop at codon 70 | |
C*07:98N | Point | Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | Tissue Antigens (2014) 83:184-189 |
C*07:104N | Point | Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | Tissue Antigens (2014) 83:184-189 |
C*07:152N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | Tissue Antigens (2014) 83:184-189 |
C*07:164N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | |
C*07:191N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | Tissue Antigens (2014) 83:184-189 |
C*07:198N | Point | Exon 2, 202-204AGA>TGA, causes R44X, a premature stop at codon 44 | |
C*07:227N | Point | Exon 2, 124-126GGA>TGA, causes 18GX, a premature stop at codon 18 | |
C*07:264N | Point | Exon 3, 535-537CAG>TAG, causes Q155X, a premature stop at codon 155 | |
C*07:329N | Point | Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 | HLA (2016) 87:31-35 |
C*07:347N | Deletion | Exon 3, 537delG, in codon 155, causes frameshift and premature stop at codon 156 | HLA (2017) 90:171-173 |
C*07:350N | Insertion | Exon 4, 706-707insG, in codon 212, causes a frame shift | HLA (2017) 90:171-173 |
C*07:393N | Deletion | Exon 3, 564delC, in codon 158, causes frameshift and premature stop at codon 189 | Tissue Antigens (2015) 85:511-512 |
C*07:437N | Deletion | Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop at codon 73 | |
C*07:451N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | |
C*07:452N | Point | Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46 | |
C*07:476N | Point | Exon 2, 265-267CAG>TAG, causes Q85X, a premature stop at codon 85 | |
C*07:483N | Point | Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161 | HLA (2017) 90:79-87 |
C*07:484N | Point | Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 | |
C*07:491:01N | Point | Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 | |
C*07:491:02N | Point | Exon 3, 469-471TAG>TGA, causes X133X, a premature stop at codon 133 | HLA (2017) 90:79-87 |
C*07:507N | Point | Exon 2, 259-261GAG>TAG, causes E63X, a premature stop at codon 63 | HLA (2017) 90:79-87 |
C*07:551N | Deletion | Exon 3, 596-606delGGAAGGAGACG causing frameshift and premature stop at codon 192 | HLA (2017) 90:79-87 |
C*07:593N | Point | Exon 4, 893G>A, causes W148X, premature stop at codon 148 | |
C*07:600:01N | Point | Exon 2, 224G>A, causes W51X, a premature stop at codon 51 | |
C*07:600:02N | Point | Exon 2, 225G>A, causes W51X, a premature stop at codon 51 | |
C*07:603N | Point | Exon 2, 225G>A, causes W51X, at premature stop at codon 51 | |
C*07:633N | Point | Exon 3, 562-564TGC>TGA, causes X164, a premature stop in codon 164 | |
C*07:672N | Insertion | Exon 2, 96-97insTT, in codon 8, causes frameshift and premature stop in codon 77 | |
C*07:675N | Point | Exon 4, 856-858CAG>TAG, causes X262, a premature stop in codon 262 | |
C*07:686N | Point | Exon 4, 721-723TGG>TAG, causes X217, a premature stop in codon 217 | |
C*07:690N | Point | Exon 3, 571-573TGG>TGA, causes X167, a premature stop in codon 167 | |
C*07:702N | Point | Exon 2, 426-428TAC>TAG, causes X118, a premature stop at codon 118 | |
C*07:726N | Deletion | Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop in codon 113 | |
C*07:733N | Point | Exon 3, 454-456GAG>TAG, causes X128, a premature stop at codon 128 | |
C*07:743N | Deletion | Exon 4, 871delC, in codon 266, causes a frameshift and premature stop at codon 272 | |
C*07:745N | Deletion | Exon 2, 177-178delGT, in codon 35-36, causes a frameshift and premature stop at codon 73 | |
C*07:746N | Deletion | Exon 3, 359-365delAGAGGAT, in codons 96-98, causes a frameshift and premature stop at codon 124 | |
C*07:747N | Deletion | Exon 3, 352-353delAC, in codon 94, causes a frameshift and premature stop at codon 113. | |
C*07:749N | Deletion | Exon 2, 216delT, in codon 51, causes a frameshift and premature stop at codon 76 | |
C*07:750N | Insertion | Exon 2, 242insC, in codon 57, causes a frameshift and premature stop at codon 74. | |
C*07:751N | Insertion | Exon 2, 185insA, in codon 38, causes frameshift and premature stop at codon 74 | |
C*07:752N | Insertion | Exon 2, 204insA, in codon 45, causes frameshift and premature stop at codon 74 | |
C*07:753N | Insertion | Exon 2, 173insT, in codon 34 causes a frameshift and premature stop at codon 74. | |
C*07:754N | Insertion | Exon 3, 584insA, in codon 171, causes a frameshift and premature stop at codon 171 | |
C*07:770N | Point | Exon 3, 598-600AAG>TAG, causes K176X, a premature stop at codon 176 | |
C*07:773N | Insertion | Exon 2, 267insT, in codon 66, causes frameshift and premature stop at codon 66 | |
C*07:776N | Deletion | Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop in codon 113 | |
C*07:787N | Insertion | Exon 3, 584insA in codon 171, causes frameshift and premature stop at codon 171 | |
C*07:796N | Deletion | Exon 4, 737delA in codon 222, causes frameshift and premature stop at codon 272 | |
C*07:797N | Point | Exon 4, 892-894TGG>TGA, causes W274X, a premature stop at codon 274 | |
C*07:804N | Deletion | Exon 3, 565delG, in codon 165, causes frameshift and premature stop at codon 189. | |
C*07:807N | Insertion | Exon 4, 899insC, in codon 276, causes frameshift and premature stop at codon 310 | |
C*07:820N | Point | Exon 3, 508-510, AAG>TAG, causes X146, a premature stop at codon 146 | |
C*07:821N | Insertion | Exon 2, 166-167insGC, in codon 32, causes frameshift and premature stop at codon 77 | |
C*07:833N | Point | Exon 4, 697-699, TAC>TAA causes X209, a premature stop at codon 209 | |
C*07:839N | Deletion | Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113 | HLA (2020) 95:142-143 |
C*07:840N | Point | Exon 4, 700-702, TAC>TAA, causes X209, a premature stop at codon 209 | HLA (2020) 96:99-101 |
C*07:849N | Deletion | Exon 2, 267delG in codon 65, causes frameshift and premature stop at codon 76 | |
C*07:856N | Point | Exon 3, 580-582, AGA>TGA, causes X170, a premature stop at codon 170 | |
C*07:863N | Deletion | Exon 3, 388-389delGA, causes X113, a frameshift and premature stop at codon 113. | |
C*07:881N | Deletion | Exon 3, 434delA in codon 121, causes a frameshift and premature stop at codon 126 | |
C*07:886N | Point | Exon 4, 829-831CAA>TAA, causes E253X, a premature stop in codon 253 | |
C*07:889N | Deletion | Exon 2, 185delG, in codon 38, causes a frameshift and premature stop in codon 76 | |
C*07:934N | Point | Exon 4, 736-738GAG>TAG, causes X222, a premature stop at codon 222. | |
C*07:936N | Deletion | Exon 2, 92delA, in codon 7, causes frameshift and premature stop at codon 76 | |
C*07:954N | Insertion | Exon 2, 295insC in codon 75, causes frameshift and premature stop at codon 114 | |
C*07:963N | Point | Exon 2, 271-273TAC>TAG, causes Y67X, a premature stop in codon 67 | |
C*07:970N | Deletion | Exon 2, 91-128delTATTTCGACACCGCCGTGTCCCGGCCCGGCCGCGGAG in codon 7, causes a frameshift and premature stop at codon 64 | |
C*07:981N | Point | Exon 3, 469-471, TGG>TGA, causes X133, a premature stop at codon 133. Protein changes after premature stop | |
C*07:984N | Insertion | Exon 3, 581insG in codon 170, causes frameshift and premature stop at codon 196 | |
C*07:1001N | Deletion | Exon 1, 53delCCCTGACCGAGACCTGG in codon -7, causes a frameshift and premature stop at codon 68 | HLA (2022) 100:384-385 |
C*07:1005N | Point | Exon 2, 271-273TAC>TAG, causes X67, a premature stop at codon 67 | |
C*07:1037N | Point | Exon 2, 280-282CAT>TAG, causes Q70X, a premature stop in codon 70 | |
C*07:1039N | Insertion | Exon 3, 606insG in codon 179, causes a frameshift and premature stop at codon 196 | |
C*07:1040N | Point | Exon 3, 373-375TGC>TGA, causes C101X, a premature stop in codon 101 | |
C*07:1042N | Insertion | Exon 3, 584insA in codon 171, causes frameshift and premature stop at codon 171 | |
C*07:1044N | Deletion | Exon 3, 442delA in codon 124, causes a frameshift and a premature stop at codon 126 | HLA (2023) 101:687-688 |
C*07:1054N | Deletion | Exon 1, 49delG in codon -9. causes a frameshift and premature stop at codon -6 | HLA (2023) 101:668-670 |
C*07:1062N | Point | Exon 2, 331-333CAG>TAG, causes X87, a premature stop at codon 87 | HLA (2023) 102:75-77 |
C*07:1063N | Deletion | Exon 3, 532delGG in codon 154, causes a frameshift and premature stop at codon 195 | |
C*07:1066N | Deletion | Exon 3, 583delTACCTGGAGAACGGGA in codon 171, causes a frameshift and premature stop at codon 184 | |
C*07:1067N | Point | Exon 2, 331-333CAG>TAG, causes X87, a premature stop at codon 87 | |
C*07:1074N | Point | Exon 2, 280-282CAG>TAG, causes X70, a premature stop at codon 70 | |
C*07:1100N | Deletion | Exon 3, 461delGGACCTGCGCTCCT in codon 128, causes a frameshift and premature stop at codon 191 | |
C*07:1106N | Deletion | Exon 3, 593delA in codon 174, causes a frameshift and premature stop at codon 189 | |
C*07:1120N | Deletion | Exon 2, 158delA in codon 29. causes a frameshift and premature stop at codon 77 | |
C*07:1130N | Point | Exon 3, 583-585TAC>TAG, causes X171, a premature stop at codon 171 | |
C*07:1138N | Point | Exon 3, 415-417CAG>TAG, causes X115, a premature stop at codon 115 | |
C*07:1145N | Point | Exon 4, 664-666GAG>TAG causes X198, a premature stop at codon 198 | |
C*07:1146N | Point | Exon 3, 409-411TAT>TAA, causes X113, a premature stop at codon 113 | |
C*07:1155N | Deletion | Exon 3, 481delG in codon 137, causes a frameshift and premature stop at codon 189 | |
C*07:1163N | Point | Exon 2, 223-225TGG>TGA, causes X51, a premature stop at codon 51 | |
C*08:26N | Point | Exon 3, 439-441TAC>TAG, causes Y123X, a premature stop codon at 123 | Tissue Antigens (2011) 77:54-61 |
C*08:36N | Point | Exon 3, 439-441TAC>TAG, causes Y123X, a premature stop at codon 123 | HLA (2017) 90:171-173 |
C*08:52N | Deletion | Exon 4, 678delG, in codon 202, causes frameshift and premature stop at codon 215 | |
C*08:55N | Point | Exon 2, 175-178CGG>TAG, causes R35X, a premature stop at codon 35 | |
C*08:88N | Deletion | Exon 3, 421-427delGCCTACG, in codon 117-119, causes a frame shift and premature stop at codon 124 | |
C*08:89N | Insertion | Exon 2, 133>134InsC, in codon 21, causes a frame shift and premature stop at codon 74 | |
C*08:121N | Deletion | Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop at codon 73 | HLA (2016) 87:55-56 |
C*08:127N | Insertion | Exon 3, 434-435insG, in codon 121, causes frameshift and premature stop at codon 128 | |
C*08:129N | Insertion | Exon 3, 437-438insA, in codon 121, causes frameshift and premature stop at codon 128 | |
C*08:130N | Point | Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46 | |
C*08:161N | Insertion | Exon 2, 155-186insGGAGAGCCCCGCTTCATCGCAGTGGGCTACG, in codon 28, causes frameshift and premature stop at codon 84 | |
C*08:173N | Point | Exon 2, 250-252TGG>TGA, causes X60, a premature stop in codon 60 | |
C*08:180N | Deletion | Exon 2, 352-353delAC, in codon 94, causes a frameshift and premature stop at codon 113 | |
C*08:181N | Deletion | Exon 2, 327delC in codon 85, causes frameshift and premature stop at codon 85 | |
C*08:208N | Point | Exon 3, 424-426, TAC>TAG, causes X118, a premature stop at codon 118. | |
C*08:214:01N | Point | Exon 2, 250-253TGG>TAA, causes W60X, a premature stop in codon 60 | |
C*08:214:02N | Point | Extends to third field. Exon 2, 250-252TGG>TAG, causes X60, a premature stop at codon 60. | |
C*08:224N | Insertion | Exon 3, 507insC in codon 146, causes frameshift and premature stop at codon 152 | HLA (2023) 101:507-512 |
C*08:236N | Point | Exon 5, 907-909CAG>TAG, causes X279, a premature stop at codon 279 | HLA (2023) 101:184-185 |
C*12:39N | Point | Exon 2, 250-252TGG>TGA, causes W60X, a premature stop at codon 60 | Tissue Antigens (2014) 83:184-189 |
C*12:46N | Point | Exon 3, 424-429TAC>TAG, causes Y118X, a premature stop at codon 118 | Tissue Antigens (2014) 83:184-189 |
C*12:80N | Point | Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 | |
C*12:84N | Insertion | Exon 2, 202-204insA, in codon 44, causes frame shift and premature stop at codon 74 | |
C*12:104N | Point | Exon 3, 502-504CAG-TAG, causes Q144X, a premature stop at codon 144 | |
C*12:105N | Point | Exon 3, 514-516GAG>TAG, causes E148X, a premature stop at codon 148 | HLA (2017) 90:171-173 |
C*12:148N | Point | Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65 | |
C*12:219N | Point | Exon 3, 508A>T, causes K146X, a premature stop at codon 146 | |
C*12:232N | Deletion | Exon 3, 564-567delCGTG, in codons 164-165, causes frameshift and premature stop in codon 188 | |
C*12:236N | Deletion | Exon 3, 573delG in codon167, causes frameshift and premature stop in codon 189 | |
C*12:270N | Deletion | Exon 3, 352-353delAC, in codon 94, causes a frameshift and premature stop at codon 113 | |
C*12:274:01N | Deletion | Exon 2, 208delG, in codon 46, causes a frameshift and premature stop at codon 76. | |
C*12:295N | Deletion | Exon 4, 746-758delCTCAGGACACCGA, in codons 225-229, causes frameshift and premature stop at codon 268 | |
C*12:311N | Deletion | Exon 2, 267-268delGA, causes frameshift and premature stop at codon 73 | |
C*12:324N | Deletion | Exon 4, 875delA, in codon 268, causes a frameshift and premature stop in codon 268 | |
C*12:327N | Point | Exon 3, 619621GAA>TAA, causes E183X, a premature stop in codon 183 | |
C*12:329N | Deletion | Exon 2, 208delG, in codon 46, causes a frameshift and premature stop at codon 76. | |
C*12:343N | Deletion | Exon 3, 537delG in codon 155, causes frameshift and premature stop at codon 189 | |
C*12:345N | Point | Exon 2, 469-471TGG>TAG, causes X133, a premature stop at codon 133 | |
C*12:421N | Deletion | Exon 1, 22delA in codon -17, causes a frameshift and premature stop at codon -6 | |
C*12:428N | Point | Exon 3, 454-456GAG>TAG, causes X128, a premature stop at codon 128 | |
C*14:07N | Point | Exon 3, 583-585TAC-TAA, causes Y171X, a premature stop at codon 171 | |
C*14:21N | Point | Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | HLA (2017) 90:171-173 |
C*14:35N | Point | Exon 3 361-363TGG>TGA, causes W97X, a premature stop at codon 97 | |
C*14:47:01N | Point | Exon 3, 469-471TGG>TGA, causes W133X, a premature stop at codon 133 | |
C*14:47:02N | Point | Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 | |
C*14:93N | Point | Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop in codon 144 |
HLA (2018) 92:107-108 HLA (2018) 92:107-108 |
C*14:97N | Point | Exon 2, 250-252TGG>TGA, causes X60, a premature stop in codon 60 | |
C*14:99N | Insertion | Exon 4, 246-249insCGGA, in codon 58, causes frameshift and premature stop in codon 76 | |
C*14:117N | Point | Exon 4, 889-891, AGA>TGA, causes X273, a premature stop at codon 273 | |
C*14:141N | Deletion | Exon 2, 244delG in codon 58, causes frameshift and premature stop at codon 76 | |
C*14:148N | Deletion | Exon 3, 381delG in codon 103, cause a frameshift and premature stop at codon 126 | |
C*14:156N | Point | Exon 3, 554-556GAG>TAG, causes X160, a premature stop at codon 160 | |
C*15:02:01:08N | Point | Intron 2, g431A>T, causes incorrect splicing and the deletion of 17bp, resulting in a frameshift and premature stop codon | HLA (2018) 91:187-194 |
C*15:92N | Point | Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop codon at 96 | |
C*15:95N | Point | Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon in 65 | HLA (2016) 87:31-35 |
C*15:115N | Point | Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 | |
C*15:122N | Point | Exon 2, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | HLA (2018) 92:304-309 |
C*15:145N | Point | Exon 3, 589G>T, causes E173X, premature stop at codon 173 | |
C*15:156N | Deletion | Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop in codon 73 | |
C*15:160N | Point | Exon 2, 802-804TGG>TGA, causes X244, a premature stop in codon 244 | HLA (2020) 96:227-229 |
C*15:164N | Point | Exon 4, 682-684TGG>TGA, causes X204, a premature stop in codon 204 | |
C*15:177N | Deletion | Exon 3, 426delC, in codon 118, causes a frameshift and premature stop at codon 118. | |
C*15:185N | Deletion | Exon 3, 590-596delAGAACGG, in codons 173-175, causes frameshift and premature stop in codon 187 | |
C*15:188N | Deletion | Exon 2, 261delG, in codon 63, causes a frameshift and premature stop at codon 76 | |
C*15:189N | Insertion | Exon 2, 240-253insGCCGGAGTATTGGG, in codon 61, causes a frameshift and premature stop at codon 81 | |
C*15:213N | Deletion | Exon 4, 736delG, in codon 222, causes frameshift and premature stop at codon 272 | |
C*15:216N | Point | Exon 2, 244-246GAG>TAG, causes E58X, a premature stop in codon 58. | |
C*15:238N | Insertion | Exon 3, 384insG, in codon 105, causes a frameshift and premature stop in codon 114 | |
C*15:247N | Deletion | Exon 3, 415delC, in codon 115, causes a frameshift and premature stop in codon 116 | |
C*15:256N | Point | Exon 2, 295-297CGA>TGA, causes X75, a premature stop at codon 75 | |
C*15:269N | Insertion | Exon 3, 568insCGTG in codon 166, causes a frameshift and premature stop at codon 195 | |
C*15:271N | Insertion | Exon 3, 350insC in codon 93, causes a frameshift and premature stop at codon 114 | |
C*15:291N | Point | Exon 2, 310-313AAA>TAA, causes X80, a premature at stop at codon 80 | |
C*16:30N | Point | Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87 | Tissue Antigens (2014) 83:184-189 |
C*16:77N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | HLA (2017) 90:79-87 |
C*16:89N | Point | Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 | |
C*16:123N | Point | Exon 2, 271-273TAC>TAG, causes X67, a premature stop in codon 67 | HLA (2019) 93:505-506 |
C*16:132N | Point | Exon 3, 361-363TGG>TGA, causes X97, a premature stop in codon 97 | |
C*16:186N | Insertion | Exon 4, 842insGATA, in codon 257, causes a frameshift and premature stop in codon 257 | |
C*16:195N | Insertion | Exon 3, 618insCG, causes a frameshift and premature stop in codon 190 | |
C*16:206N | Point | Exon 2, 295-297CGA>TGA, causes X75, a premature stop at codon 75 | |
C*16:219N | Point | Exon 3, 409-411TAT>TAG, causes X113, a premature stop at codon 113 | |
C*16:220N | Point | Exon 2, 250-253TGG>TGA, causes X60, a premature stop at codon 60 | |
C*17:27N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | HLA (2016) 87:31-35 |
C*18:07N | Point | Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 | |
E*01:08:01N | Point | Exon 2, 313-315TAC>TAG, causes Y84X, a premature stop at codon 84 | HLA (2017) 89:143-149 |
E*01:08:02N | Point | Exon 2, 313-315TAC>TAG, causes Y84X, a premature stop at codon 84 | HLA (2021) 97:389-398 |
E*01:21:01N | Point | Exon 3, 349-351CAG>TAG, causes X96, a premature stop at codon 96 | HLA (2021) 97:389-398 |
E*01:25N | Point | Exon 1, 316-318TAC>TAG, causes X85, a premature stop at codon 85 | HLA (2021) 97:389-398 |
E*01:55N | Point | Exon 3, 364-366, TGC>TGA, causes X101, a premature stop at codon 101 | HLA (2021) 97:389-398 |
E*01:91N | Point | Exon 3, 400-402, TAT>TAA causes X113, a premature stop at codon 113 | HLA (2021) 97:389-398 |
E*01:117N | Point | Exon 3, 349-351CAG>TAG, causes X96, a premature stop at codon 96 | HLA (2021) 97:389-398 |
E*01:126N | Deletion | Exon 3, 373-378delGGGCC in codon 104-105, causes a frameshift and premature stop at codon 112 | |
E*01:139N | Point | Exon 2, 241-243TGG>TGA, causes W60X, a premature stop in codon 60 | |
E*01:141N | Point | Exon 2, 142-144TAC>TAG, causes Y27X, a premature stop in codon 27 | |
F*01:13N | Point | Exon 2, 143-145TAC>TAG, causes Y27X, a premature stop in codon 27 | |
F*01:14:01:01N | Point | Exon 3, 415-418TAC>TAA, causes Y118X, a premature stop in codon 118 | |
F*01:14:01:02N | Point | Exon 3, 415-418TAC>TAA, causes Y118X, a premature stop in codon 118 | |
G*01:05:01N | Deletion | Exon 3, 460delC, in codon 130, causes frameshift and premature stop at codon 189 |
Immunogenetics (1997) 45:464-465 Immunogenetics (2006) 58:241-251 |
G*01:05:02N | Deletion | Exon 3, 460delC, in codon 130, causes frameshift and premature stop at codon 189 | |
G*01:13N | Point | Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 | Tissue Antigens (2008) 72:491-505 |
G*01:21N | Point | Exon 3, 748C>T, causes Q226X, premature stop at codon 226 | HLA (2018) 91:146-147 |
G*01:25N | Deletion | Exon 3, 443-4delTC in codon 124, causes frameshift and premature stop at codon 147. | |
G*01:28N | Point | Exon 3 409-411TAT>TAA, causes Y113X, a premature stop in codon 113 | |
DRB1*01:33N | Deletion | Exon 2, 123delG, causes frameshift and premature stop codon at 50 | Tissue Antigens (2011) 78:463-464 |
DRB1*01:39N | Point | Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9 | Tissue Antigens (2014) 84:497-502 |
DRB1*01:40N | Point | Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9 | |
DRB1*01:52N | Point | Exon 2, 336-338TAC>TAG, causes Y83X, a premature stop at codon 83 | |
DRB1*01:62:01N | Point | Exon 2, 268-270TGG>TGA, causes W61X, a premature stop at codon 61 | |
DRB1*01:62:02N | Point | Exon 2, 268-270TGG>TAG, causes W61X, a premature stop at codon 61 | |
DRB1*01:68N | Point | Exon 2, 295-297CAG>TAG, causes Q70X, a premature stop at codon 70 | |
DRB1*01:131N | Deletion | Exon 2, 121-126delAAGTT, causes a frameshift and premature stop in codon 12 | |
DRB1*03:67N | Point | Exon 2, 268-270TGG>TGA, causes W61X, a premature stop at codon 61 | Tissue Antigens (2014) 84:497-502 |
DRB1*03:68N | Point | Exon 2, 367-369CGA>TGA, causes R94X, a premature stop at codon 94 | |
DRB1*03:156N | Deletion | Exon 2, 258-273delTGCCGAGTACTGGAAC, in codons 57-62, causes a premature stop at codon 94 | |
DRB1*03:174N | Insertion | Exon 2, 308insC, in codon 74, causes a frameshift and premature stop in codon 98 | |
DRB1*03:189N | Point | Exon 2, 262-264GAG>TAG, causes E59X, a premature stop in codon 59 | |
DRB1*03:204N | Point | Exon 3, 406-409CAG>TAG, causes X107, a premature stop at codon 107 | |
DRB1*03:218N | Insertion | Exon 2, 305insG in codon 77, causes a frameshift and premature stop at codon 98 | HLA (2024) 104:- |
DRB1*04:81N | Deletion | Exon 2, 296-297delAG, in codon 70, causes frameshift and premature stop at codon 86 | |
DRB1*04:94:01N | Point | Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78 | Tissue Antigens (2011) 78:226-227 |
DRB1*04:119N | Point | Exon 2, 334-336TAC>TAG, causes Y83X, a premature stop at codon 83 | Tissue Antigens (2014) 84:497-502 |
DRB1*04:120N | Point | Exon 2, 319-332TAC>TAA, causes Y78X, a premature stop at codon 78 | Tissue Antigens (2014) 84:497-502 |
DRB1*04:142N | Point | Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83 | Tissue Antigens (2014) 84:497-502 |
DRB1*04:157N | Point | Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78 | |
DRB1*04:158N | Insertion | Exon 2, 304-305insG, in codon 73, causes a frame shift and premature stop codon at codon 87 | |
DRB1*04:178N | Insertion | Exon 2, 318-319insC, in codon 87, causes frame shift and premature stop at codon at 87 | Tissue Antigens (2015) 85:78-79 |
DRB1*04:186N | Point | Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78 | |
DRB1*04:212N | Point | Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78 | |
DRB1*04:214N | Point | Exon 2, 187-189CAA>TAA, causes Q34X, a premature stop at codon 34 | |
DRB1*04:247N | Point | Exon 2, 268-270TGG>TGA, causes X61, a premature stop in codon 61 | |
DRB1*04:264N | Point | Exon 2, 169-171GAC>TAA, causes X28, a premature stop in codon 28 | |
DRB1*04:266N | Deletion | Exon 3, 498delA, in codon 137, causes a frameshift and premature stop at codon 147 | |
DRB1*04:267N | Insertion | Exon 2, 305insG, in codon 73, causes a frameshift and premature stop at codon 98 | |
DRB1*04:280N | Point | Exon 2, 181-183TAT>TAA, causes Y32X, a premature stop in codon 35 | |
DRB1*04:286N | Point | Exon 3, 406-408CAG>TAG, causes Q107X, a premature stop in codon 107 | |
DRB1*04:299N | Insertion | Exon 2, 288insC, in codon 68, causes frameshift and premature stop at codon 98 | |
DRB1*04:300N | Deletion | Exon 3, 489delC, in codon 134, causes frameshift and premature stop at codon 147 | |
DRB1*04:312N | Point | Exon 2, 127-129GAG>TAG, causes E14X, a premature stop in codon 14 | |
DRB1*04:329N | Point | Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop in codon 64 | |
DRB1*04:379N | Point | Exon 1, 97-99CGA>TGA, causes X4, a premature stop at codon 4 | HLA (2024) 104:- |
DRB1*04:380N | Point | Exon 226-228TAC>TAA, causes X47, a premature stop at codon 47. | |
DRB1*04:389N | Insertion | Exon 3, 580insC in codon 158, causes a frameshift and premature stop at ccodon 193 | |
DRB1*07:10N | Deletion | Exon 2, 175-176delTG, in codon 30, causes frameshift and premature stop at codon 32 | Immunogenetics (2007) 59:507-510 |
DRB1*07:26N | Insertion | Exon 2, 172-173insA, in codon 29, causes a frame shift and a premature stop at codon 33 | |
DRB1*07:58N | Point | Exon 2, 160-162CAG>TAG, causes R25X, a premature stop at codon 25 | |
DRB1*07:68N | Deletion | Exon 2, 278delA, in codon 64, causes frameshift and premature stop at codon 99 | |
DRB1*07:87N | Point | Exon 2, 367-369CGA>TGA, causes X94, a premature stop in codon 94 | |
DRB1*07:101N | Deletion | Exon 3, 262delC in codon 59, causes frameshift and premature stop at codon 99 | |
DRB1*07:118N | Point | Exon 2, 115-117, CAG>TAG, causes X10, a premature stop at codon 10 | |
DRB1*07:129N | Point | Exon 2, 187CAG>TAG, causes Q34X, a premature stop in codon 34 | HLA (2022) 99:133-134 |
DRB1*07:143N | Point | Exon 3, 592-594GAA>TAA, causes E169X, a premature stop in codon 169. | HLA (2023) 102:375-377 |
DRB1*07:147N | Point | Exon 4, 673-675CCAG>TAG, causes X196, a premature stop at codon 196 | HLA (2024) 103:- |
DRB1*07:149N | Point | Exon 2, 112-114TGG>TAG, causes X9, a premature stop at codon 9 | |
DRB1*07:156N | Point | Exon 2, 267-269TGG>TAG, causes X61, a premature stop at codon 61 | |
DRB1*07:163N | Point | Exon 4, 745-747TAC>TAA, causes X220, a premature stop at codon 220 | |
DRB1*08:60N | Deletion | Exon 2, 341delT, in codon 85, causes frameshift and premature stop at codon 99 | |
DRB1*08:78N | Point | Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop at codon 64 | |
DRB1*08:89N | Deletion | Exon 2, 157delG, in codon 24, causes a frameshift and premature stop at codon 50 | |
DRB1*09:37N | Deletion | Exon 2, 128-131delAGTG, in codons 14-15, causes a frameshift and premature stop at codon 50 | |
DRB1*09:52N | Deletion | Exon 2, 285delC in codon 66, causes a frameshift and premature stop at codon 99 | HLA (2023) 102:343-347 |
DRB1*09:61N | Deletion | Exon 2, 6-7delCG, causes a frameshift and premature stop at codon 12 | |
DRB1*11:01:01:12N | Point | Intron 3, g8124G>C in the splice site proceeding exon 3, which may affect expression | HLA (2023) 102:765-768 |
DRB1*11:169N | Deletion | Exon 2, 326-327delGA, in codon 80, causes frameshift and premature stop at codon 86 | |
DRB1*11:217N | Point | Exon 2, 194G>T, causes E36X, premature stop at codon 36 | |
DRB1*11:246N | Insertion | Exon 2, 175insA, in codon 30, causes a frameshift and a premature stop at codon 33. | |
DRB1*11:250N | Insertion | Exon 3, 585-607insGAGTGGAGAGGTTTACACCTGCC, in codon 174, causes a frameshift and premature stop at codon 188 | |
DRB1*11:287N | Point | Exon 2, 268-270TGG>TGA, causes X61, a premature stop at codon 61 | |
DRB1*11:294N | Deletion | Exon 2, 256delGATG in codon 57, causes a frameshift and premature stop in codon 98 | |
DRB1*11:301N | Insertion | Exon 3, 631insA in codon 182, causes a frameshift and premature stop at codon 193 | |
DRB1*11:303N | Deletion | Exon 3, 524delG in codon 146, causes a frameshift and premature stop at codon 147 | |
DRB1*11:314N | Deletion | Exon 2, 303delG in codon 72, causes a frameshift and premature stop at codon 99 | |
DRB1*11:329N | Insertion | Exon 2, 298insC in codon 71, causes a frameshift and premature stop at codon 98 | |
DRB1*12:24N | Point | Exon 2, 268-270TGG>TAG, causes Y61X, a premature stop at codon 61 | Tissue Antigens (2011) 78:45-48 |
DRB1*12:31N | Point | Exon 2, 127-129GAA>TAG, causes E14X, a premature stop at codon 14 | HLA (2017) 90:171-173 |
DRB1*12:60N | Deletion | Exon 2, 157-157delG, in codon 24, causes frameshift and premature stop at codon 50 | HLA (2017) 89:65-66 |
DRB1*12:72N | Deletion | Exon 3, 409-424delCCCCTGCAGCACCACA, in codons 108-113, causes a frameshift and premature stop at codon 114 | |
DRB1*12:74N | Deletion | Exon 2, 254delC, in codon 56, causes a frameshift and premature stop at codon 99 | |
DRB1*12:86N | Point | Exon 3, 415-417CAG>TAG, causes X110, a premature stop at codon 110 | |
DRB1*12:98N | Insertion | Exon 2, 223insG in codon 46, causes a frameshift and premature stop at codon 97 | |
DRB1*13:113N | Deletion | Exon 2, 246delG, causes frameshift and premature stop at codon 99 | HLA (2017) 90:171-173 |
DRB1*13:137N | Point | Exon 2, 298-300AGG>TAG, causes R71X, a premature stop at codon 71 | Tissue Antigens (2014) 84:497-502 |
DRB1*13:142N | Point | Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop at codon 64 | Tissue Antigens (2014) 84:497-502 |
DRB1*13:185N | Point | Exon 2, 223-225GAG>TAG, causes E46X, a premature stop at codon 46 | |
DRB1*13:200N | Point | Exon 2, 112-114GAG>TAG, causes W9X, a premature stop at codon 9 | |
DRB1*13:249N | Deletion | Exon 2, 270delG, in codon 61, causes frameshift and premature stop at codon 61 | |
DRB1*13:252N | Point | Exon 2, 367-369CGA>TGA, causes X94, a premature stop in codon 94 | |
DRB1*13:255N | Point | Exon 3, 478-480TGG>TAG, causes X131, a premature stop in codon 131 | |
DRB1*13:268N | Deletion | Exon 3, 610delG, in codon 175, causes a frameshift and premature stop at codon 180 | |
DRB1*13:289N | Insertion | Exon 2, 269insTACT, in codon 61, causes a frameshift and premature stop in codon 88. | |
DRB1*13:295N | Insertion | Exon 2, 304insG in codon 73, causes frameshift and premature stop at codon 87 | |
DRB1*13:298N | Deletion | Exon 3, 415-416delCA, in codon 110, causes frameshift and premature stop at codon 127 | HLA (2022) 99:659-660 |
DRB1*13:310N | Point | Exon 2, 367-369CGA>TGA, casuses X94, a premature stop at codon 94 | |
DRB1*13:319N | Deletion | Exon 3, 501delAA, in codon 139, causes a frameshift and premature stop at codon 192 | |
DRB1*13:322N | Deletion | Exon 3, 421delC, in codon 112, causes a frameshift and premature stop in codon 119 | HLA (2022) 100:165-166 |
DRB1*13:324N | Point | Exon 3, 607-609CAA>TAA, causes Q174X, a premature stop in codon 174 | |
DRB1*13:329N | Deletion | Exon 3, 563delTG in codon 159, causes a frameshift and premature stop at codon 192 | |
DRB1*13:367N | Deletion | Exon 2, 278delC in codon 64, causing a frameshift and premature stop at codon 99 | |
DRB1*14:92N | Point | Exon 2, 190-192GAG>TAG, causes E35X, a premature stop at codon 35 | |
DRB1*14:137N | Insertion | Exon 2, 304-305insG, in codon 73, causes frame shift and premature stop at codon 98 | Tissue Antigens (2013) 82:201-202 |
DRB1*14:152N | Insertion | Exon 2, 303-304insG, in codon 73, causes a frame shift and a premature stop at codon 98 | |
DRB1*14:166N | Point | Exon 2, 173-174insA, in codon 29, causes frameshift and premature stop at codon 33 | HLA (2016) 87:60- |
DRB1*14:188N | Point | Exon 2, 113C>T, causes Q16X, premature stop at codon 116 | |
DRB1*14:195N | Point | Exon 2, 265-267TAC>TAG, causes X60, a premature stop in codon 60 | |
DRB1*14:197N | Point | Exon 2, 307-309GAG>TAG, causes X74, a premature stop in codon 74 | |
DRB1*14:222N | Point | Exon 2, 262-264, GAG>TAG, causes E59X, a premature stop in codon 59. | HLA (2021) 98:562-564 |
DRB1*14:231N | Deletion | Exon 2, 118-123delTCTAC in codon 11-12, causes frameshift and premature stop at codon 12 | |
DRB1*14:254N | Point | Exon 2, 292-294GAG>TAG, causes E69X, a premature stop in codon 69 | |
DRB1*14:269N | Point | Exon 3, 479-481TGG>TAG, causes X131, a premature stop at codon 131 | |
DRB1*15:17N | Insertion | Exon 2, 294-295insGA, in codon70, causes frameshift and premature stop at codon 100 | Tissue Antigens (2005) 66:334-335 |
DRB1*15:50N | Deletion | Exon 2, 303-304delGG, causes frameshift and premature stop at codon 97 | |
DRB1*15:80N | Deletion | Exon 2, 303-304delGG, in codon 71, causes frameshift and premature stop at codon 86 | |
DRB1*15:113N | Point | Exon 2, 115-117CAG>TAG, causes Q10X, a premature stop at codon 10 | |
DRB1*15:115N | Deletion | Exon 2, 295-296delGA, in codon 70, causes frameshift and premature stop at codon 86 | Tissue Antigens (2015) 86:69-70 |
DRB1*15:129N | Deletion | Exon 2, 303-304delGG, in codons 72-73, causes frameshift and premature stop at codon 97 | |
DRB1*15:134N | Deletion | Exon 2, 142-143delTG, in codon 19, causes frameshift and premature stop at codon 32 | |
DRB1*15:137N | Point | Exon 2, 187-189CAG>TAG, causes Q34X, a premature stop at codon 34 | |
DRB1*15:138N | Insertion | Exon 2, 158-158insG, in codon 24, causes frameshift and premature stop at codon 33 | |
DRB1*15:148N | Deletion | Exon 2, 187delC in codon 34, causes frameshift and premature stop in codon 50 | HLA (2018) 91:544-545 |
DRB1*15:154N | Point | Exon 3, 615-617GAG>TAG, causes X176, a premature stop in codon 176 | |
DRB1*15:159N | Point | Exon 2, 367-369CGA>TGA, causes X94, a premature stop in codon 94 | |
DRB1*15:163N | Deletion | Exon 3, 406delC, in codon 107, causes a frameshift and premature stop in codon 119 | |
DRB1*15:176N | Insertion | Exon 2, 259insGC, in codon 58, causes a frameshift and premature stop in codon 100 | HLA (2019) 94:462-463 |
DRB1*15:180N | Point | Exon 3, 373-375, CAA>TAA, causes X96, a premature stop at codon 96 | |
DRB1*15:183N | Deletion | Exon 2, 224delA in codon 46, causes frameshift and premature stop at codon 50 | |
DRB1*15:200:01:01N | Insertion | Exon 2, 190insG, in codon 35, causes a frameshift and premature stop in codon 57 | |
DRB1*15:200:01:02N | Insertion | Exon 2, 190insG in codon 35, causes a frameshift and premature stop at codon 57 | |
DRB1*15:207N | Deletion | Exon 2, 164-170delTCCTGGA in codon 26, causes frameshift and premature stop at codon 48 | |
DRB1*15:209N | Deletion | Exon 2, 270delG in codon 61, Causes X61, a frameshift and premature stop at codon 61 | |
DRB1*15:217N | Deletion | Exon 3, 443-445delTG, in codon 119, causes a frameshift and premature stop in codon 127 | |
DRB1*15:231N | Deletion | Exon 2, 273delACAGCCAGAAGGA in codon 62, causes X95, a premature stop at codon 95 | |
DRB1*16:13N | Point | Exon 2, 241-243GAG>TAG, causes E52X, a premature stop at codon 52 | Tissue Antigens (2008) 71:180-182 |
DRB1*16:21N | Deletion | Exon 2, 170-171delAA, in codon 28, causes frameshift and premature stop at codon 32 | |
DRB1*16:41N | Point | Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83 | |
DRB1*16:55N | Insertion | Exon 2, 303-304insGG, in codon 73, causes a frameshift and premature stop in codon 100 | |
DRB1*16:62N | Insertion | Exon 2, 134insA, in codon 16, causes frameshift and premature stop at codon 33 | |
DRB1*16:63N | Deletion | Exon 2, 216delC, in codon 43, causes a frameshift and premature stop at codon 50 | |
DRB1*16:70N | Insertion | Exon 2, 305insGG, in codon 73, causes a frameshift and premature stop at codon 100 | |
DRB1*16:77N | Deletion | Exon 3, 561delTGGTGATGCTGGAAAC in codon 158, causes X175, a premature stop | |
DRB3*01:26N | Point | Exon 2, 175-177TAC>TAA, causes C30X, a premature stop at codon 30 | |
DRB3*01:40:01N | Point | Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83 | |
DRB3*01:40:02N | Point | Exon 2, 334-336TAC>TAG, causes X83, a premature stop in codon 83 | |
DRB3*01:73N | Insertion | Exon 2, 224insG in codon 46, causes frameshift and premature stop at codon 87 | |
DRB3*01:77N | Point | Exon 2, 367-369CGA>TGA, causes R94X, a premature stop at codon 94. | |
DRB3*01:81N | Deletion | Exon 2, 207delC, in codon 40, causes frameshift and premature stop at codon 50 | |
DRB3*01:97N | Deletion | Exon 2, 222delG, in codon 46, causes a frameshift and premature stop in codon 50. | Human Immunology (2021) 82:982-984 |
DRB3*01:105N | Deletion | Exon 2, 339-340delGG, in codon 84, causes a frameshift and premature stop at codon86 | |
DRB3*01:117N | Insertion | Exon 2, 120insT in codon 12, causes a frameshift and premature stop in codon 12 | |
DRB3*01:132N | Point | Exon 3, 415-417CAG>TAG, causes X110, a premature stop at codon 110 | |
DRB3*01:133N | Point | Exon 1, 91-99CGA>TGA, causes X4, a premature stop at codon 4 | |
DRB3*02:29N | Deletion | Exon 3, 588-592delTGGAG, in codons 167-169, causes frameshift and premature stop at codon 191 | |
DRB3*02:55N | Point | Exon 2, 334-336TAC>TAG, causes Y83X, a premature stop at codon 83 | |
DRB3*02:67N | Point | Exon 2, 277C>T, causes Q64X, a premature stop at codon 64 | |
DRB3*02:80:01N | Point | Exon 2, 268-270TGG>TGA, causes X61, a premature stop in codon 61 | |
DRB3*02:80:02N | Point | Exon 2, 269-271TGA>TAG, causes X61, a premature stop at codon 61 | |
DRB3*02:95N | Deletion | Exon 2, 225delG, in codon 46, causes a frameshift and premature stop in codon 50 | |
DRB3*02:109N | Point | Exon 2, 307-307CAG>TAG, causes Q34X, a premature stop in codon 74 | |
DRB3*02:121N | Insertion | Exon 2, 260-263insCCGA, in codon 59, causes frameshift and premature stop at codon 88 | |
DRB3*02:125N | Insertion | Exon 2, 258insT, in codon 58, causes frameshift and premature stop at codon 87 | |
DRB3*02:137N | Insertion | Exon 2, 304insG, in codon 73, causes frameshift and premature stop at codon 87 | |
DRB3*02:145N | Point | Exon 3, 607-609CAA>TAA, causes Q174X, a premature stop at codon 174 | |
DRB3*02:165N | Point | Exon 3, 478-480TGG>TGA, causes X131, a premature stop at codon 131 | |
DRB3*02:179N | Point | Exon 3, 379-381CAG>TAG, causes Q98X, a premature stop in codon 98 | HLA (2022) 100:658-659 |
DRB3*02:187N | Point | Exon 2, 223-225GAT>TAG, causes X46, a premature stop at codon 46 | |
DRB3*02:206N | Insertion | Exon 2, 309insC in codon 74, causes a frameshift and premature stop at codon 87 | |
DRB3*02:214N | Point | Exon 3, 454-456TAT>TAG, causes X123, a premature stop at codon 123 | |
DRB3*03:30N | Deletion | Exon 2, 231delG in codon 46, causes X50, frameshift and premature stop at codon 50 | |
DRB4*01:03:01:02N | Point | Intron 1, 9656G>A, causes a mutation in the splice site preceding exon 2, causing incorrect splicing and the deletion of 17bp, resulting in a frameshift and premature stop codon |
Immunogenetics (1990) 31:112-117 Immunogenetics (1990) 31:112-117 Tissue Antigens (1997) 49:152-159 HLA (2022) 99:328-356 HLA (2022) 99:328-356 HLA (2022) 99:328-356 |
DRB4*01:03:01:13N | Point | Intron 1, g9656G>A, causes a mutation in the splice site preceding exon 2, causing incorrect splicing and the deletion of 17bp, resulting in a frameshift and premature stop codon | |
DRB4*01:14N | Point | Intron 1, g9656G>A, causes incorrect splicing and the deletion of 17bp, resulting in a frameshift and premature stop codon | HLA (2020) 95:73-75 |
DRB4*01:16N | Point | Exon 2, 265-267TAC>TAG, causes Y60X, a premature stop at codon 60 | |
DRB4*01:38N | Point | Exon 2, 361-363CAG>TAG causes Q92X, a premature stop at codon 92 | |
DRB4*01:54:01N | Point | Exon 2, 367C>T, causes R94X, premature stop at codon 94 | |
DRB4*01:54:02N | Point | Exon 2, 367369CGA>TGA, causes R94X, a premature stop in codon 94 | |
DRB4*01:56N | Point | Exon 2, 277C>T, causes Q64X, premature stop at codon 64 | |
DRB4*01:57N | Point | Exon 2, 183T>G, causes Y32X, a premature stop at codon 32 | |
DRB4*01:61:01N | Point | Exon 2, 330C>G, causes Y80X, a premature stop at codon 80 | |
DRB4*01:61:02N | Point | Exon 2, 329-331TAC>TAA, causes X80, a premature stop at codon 80 | |
DRB4*01:65N | Point | Exon 2, 154-156CGA>TGA, causes R23X, a premature stop in codon 23 | |
DRB4*01:71N | Point | Exon 2, 334-336TAC>TAG, causes X83, a premature stop in codon 83 | |
DRB4*01:80N | Insertion | Exon 2, 291insT, in codon 68, causes a frameshift and premature stop in codon 98 | |
DRB4*01:84N | Deletion | Exon 2, 267delC, in codon 60, causes a frameshift and premature stop in codon 99 | |
DRB4*01:108N | Deletion | Exon 2, 212delG, in codon 42, causes frameshift and premature stop at codon 50 | |
DRB4*01:113N | Deletion | Exon 2, 139delC, in codon 18, causes frameshift and premature stop at codon 27 | |
DRB4*01:115N | Deletion | Exon 1, 125-128delTTGA, in codons 13-14, causes frameshift and premature stop at codon 26 | |
DRB4*01:121N | Point | Exon 1, 115-117, CAG>TAG, causes X10, a premature stop at codon 10 | |
DRB4*01:128N | Point | Exon 3, 391-393TAT>TAA, causes Y102X, a premature stop in codon 102 | |
DRB4*01:145N | Deletion | Exon 3, 395delC in codon 103, causes frameshift and premature stop at codon 119 | |
DRB4*01:149N | Point | Exon 2, 229-231CAG>TAG, causes R48X, a premature stop in codon 48. | |
DRB4*01:159N | Deletion | Exon 2, 356delCAGTGCAGCGGCGA in codon 90-94, causes a framshift and premature stop at codon 93. | |
DRB4*01:162N | Point | Exon 3, 478-480TGG>TAG, causes W131X, a premature stop in codon 131 | HLA (2022) 100:659-660 |
DRB4*01:165N | Deletion | Exon 3, 401delA in codon 105, causes a frameshift and premature stop codon 119 | HLA (2023) 101:699-700 |
DRB4*02:01N | Deletion | Exon 2, 155-165delGGGTGCGGTTG, in codons 23-26, causes frameshift and premature stop at codon 29 | Immunogenetics (1997) 46:104-110 |
DRB4*03:01N | Deletion | The allele contains sequence for intron 2 and exon 3, but has no preceding exon sequences |
Immunogenetics (1997) 46:104-110 Human Immunology (2018) 79:491-493 |
DRB5*01:08:01N | Deletion | Exon 3, 572-590delAAACAGTTCCTCGGAGTGG, in codons 162-168, causes frameshift and possible stop codon after 171 |
Tissue Antigens (1997) 50:326-333 Human Immunology (2019) 80:437-448 HLA (2022) 99:328-356 |
DRB5*01:08:02N | Deletion | Exon 3, 573-591delAACAGTTCCTCGGAGTGGA in codons 162-168, causes frameshift and premature stop at codon 174 | |
DRB5*01:10N | Deletion | Exon 2, 326- 327delGA, in codon 80, causes frameshift and premature stop at codon 86 | Tissue Antigens (2000) 55:467-469 |
DRB5*01:27N | Point | Exon 2, 336C>G, causes Y83X, a premature stop at codon 83 | |
DRB5*01:48N | Point | Exon 2, 265-267TAC>TAG, causes X60, a premature stop at codon 60 | |
DRB5*01:49N | Point | Exon 3, 553-555CAG>TAG, causes X156, a premature stop at codon 156. | |
DRB5*01:52N | Deletion | Exon 2, 189-190delAG, in codons 34-35, causes a frameshift and premature stop at codon 56 | |
DRB5*01:53N | Insertion | Exon 2, 247-248insTG, in codon 54, causes a frameshift and premature stop at codon 100 | |
DRB5*01:58N | Insertion | Exon 2, 303-304insGG, in codon 72, causes a frameshift and premature stop in codon 100 | |
DRB5*01:67N | Insertion | Exon 2, 288insT in codon 67, causes frameshift and premature stop at codon 8 | |
DRB5*01:68N | Point | Exon 2, 124-126TAT>TAA, causes Y13X, a premature stop at codon 13 | |
DRB5*01:71N | Insertion | Exon 2, 290insG, in codon 68, causes frameshift and premature stop at codon 87 | |
DRB5*01:81N | Insertion | Exon 2, 318insC, in codon 78, causes a frameshift and premature stop at codon 87 | |
DRB5*01:83N | Insertion | Exon 2, 224insA, in codon 46, causes frameshift and premature stop at codon 57 | |
DRB5*01:92N | Point | Exon 2, 321-323TAC>TAG, causes Y78X, a premature stop in codon 78 | |
DRB5*01:101N | Insertion | Exon 2, 108insT in codon 7, causes frameshift and premature stop at codon 12 | |
DRB5*01:120N | Deletion | Exon 2, 298-299delAG in codon 70, causes a frameshift and premature stop at codon 86 | |
DRB5*01:121N | Deletion | Exon 2, 303delGG in codon 72, causes a frameshift and premature stop at codon 86 | |
DRB5*01:125N | Deletion | Exon 2, 296delGA in codon 70, causes a frameshift and premature stop at codon 86 | |
DRB5*01:127N | Deletion | Exon 2, 573delAACAGTTCCTCGGAGTGGA in codons 162-168, causes a frameshift and premature stop at codon174 | |
DRB5*01:131N | Deletion | Large deletion of 366bps from position g8034 in intron 1 to position g8399 intron 2. | |
DRB5*01:134N | Point | Exon 2, 334-336TAC>TAG, causes Y83X, a premature stop in codon 83 | |
DRB5*02:19N | Point | Exon 2, 319-321TAC>TAA, causes X78, a premature stop in codon 78 | |
DRB5*02:25N | Deletion | Exon 2, 303-304delGG, in codons 72-73, causes frameshift and premature stop in codon 95 | |
DRB5*02:26N | Deletion | Exon 3, 573-591delAACAGTTCCTCGGAGTGGA, in codons 162-168, causes frameshift and premature stop in codon 174 | |
DQA1*01:15N | Point | Exon 2, 212G>A, causes W48X, a premature stop at codon 48 | HLA (2017) 90:130-131 |
DQA1*01:16N | Deletion | Exon 2, 236delG, in codon 56, causes frameshift and premature stop at codon 63 | |
DQA1*01:88N | Point | Exon 2, 247-249CAG>TAG, causes X60, a premature stop at codon 60 | |
DQA1*01:113N | Deletion | Exon 1, 31delG, in codon -13, causes a frameshift and premature stop in codon -10 | |
DQA1*01:136N | Deletion | Exon 3, 397delCT in codon 109, causes a frameshift and premature stop at codon 136 | |
DQA1*02:02N | Insertion | Exon 2, 329-330insGA, in codon 87, causes frameshift and premature stop in codon 100 | |
DQA1*02:38N | Point | Exon 2, 125-127 TAC>TAA, causes X19, a premature stop at codon 19 | |
DQA1*03:27N | Deletion | Exon 2, 179-193delTGGACCTGGAGAGG in codons 37-41, causes a frameshift and premature stop at codon 50 | |
DQA1*03:32N | Point | Exon 2, 206-208TGG>TGA, causes X46, a premature stop at codon 46 | |
DQA1*03:34N | Point | Exon 2, 208-210CAG>TAG, causes X47, a premature stop at codon 47 | |
DQA1*03:58N | Point | Exon 2, 115-117TAC>TAA, causes X16, a premature stop at codon 16 | |
DQA1*03:59N | Point | Exon 2, 196-198GAG>TAG, causes X43, a premature stop at codon 43 | |
DQA1*04:03N | Point | Exon 2, 236-238AAA>TAA, causes Q53X, a premature stop at codon 53 | Tissue Antigens (2004) 63:609-611 |
DQA1*04:12N | Point | Exon 2, 115-117TAC>TAG, causes X16, a premature stop at codon 16 | |
DQA1*04:14N | Deletion | Exon 3, 408 delC in codon 113, causes a frameshift and premature stop at codon 125 | HLA (2024) 103:- |
DQA1*05:15N | Deletion | Exon 2, 203-206delTCTG, in codons 45-46, causes a frameshift and premature stop in codon 61 | |
DQA1*05:17N | Point | Exon 3, 580-521TGG>TGA, causes W171X, a premature stop at codon 171 | |
DQA1*05:36N | Point | Exon 2, 166-169GAG>TAG, in codon 33 causes E33X, a premature stop in codon 33 | |
DQA1*05:84N | Point | Exon 3, 439-441TGG>TAG, causes X124, a premature stop at codon 124 | |
DQA1*05:85N | Deletion | Exon 3, 571delG in codon 168, causes a frameshift and premature stop at codon 178 | |
DQA1*06:05N | Deletion | Exon 2, 203-207delTCTG in codon 45, causes a frameshift and premature stop at codon 71 | |
DQB1*05:41N | Point | Exon 3, 448-450TCG>TAG, causes S118X, a premature stop at codon 118 | HLA (2017) 90:171-173 |
DQB1*05:90N | Point | Exon 3, 448-450TCG>TAG, causes S118X, a premature stop at codon 118 | |
DQB1*05:110N | Point | Exon 2, 196-198CGA>TGA, causes R34X, a premature stop at codon 34 | |
DQB1*05:128N | Point | Exon 2, 370-372CAG>TAG causes Q92X, a premature stop at codon 92 | |
DQB1*05:185N | Point | Exon 2, 472-474CAG>TAG, causes X126, a premature stop at codon 126 | |
DQB1*05:206N | Deletion | Exon 2, 279delG, in codon 61, causes a frameshift and premature stop in codon 61 | |
DQB1*05:208N | Point | Exon 2, 124-126CAG>TAG, causes Q10X, a premature stop in codon 10 | |
DQB1*05:215N | Deletion | Exon 2, 307delG, in codon 71, causes a frameshift and premature stop in codon 99 | |
DQB1*05:224N | Insertion | Exon 2, 205insT, in codon 37, causes a frameshift and premature stop in codon 57 | |
DQB1*05:235N | Point | Exon 2, 121-123TAC>TAA, causes Y9X, a premature stop in codon 9 | HLA (2021) 97:254-255 |
DQB1*05:236N | Point | Exon 2, 196-199CGA>TGA, causes R34X, a premature stop in codon 34 | HLA (2020) 96:373-375 |
DQB1*05:265N | Deletion | Exon 3, 529delA in codon 145, causes frameshift and premature stop at codon 159 | |
DQB1*05:273N | Deletion | Exon 2, 192delT, in codon 32, causes a frameshift and premature stop at codon 32 | |
DQB1*05:283N | Deletion | Exon 4, 730delT in codon 212, causes frameshift and delayed stop in the 3'UTR | |
DQB1*05:295N | Insertion | Exon 2, 152insCACCA in codon 19, causes a frameshift and premature stop at codon 29 | |
DQB1*05:316N | Deletion | Exon 2, 200delAG in codon 35, causes a frameshift and premature stop at codon 134 | |
DQB1*05:347N | Insertion | Exon 3, 536insC in codon 146, causes a frameshift and premature stop at codon 149 | |
DQB1*05:348N | Point | Exon 3, 487-489TGG>TAG, causes X131, a premature stop at codon 131 | |
DQB1*06:26N | Point | Exon 2, 181-183AGA>TGA, causes R29X, a premature stop at codon 29 | |
DQB1*06:54N | Point | Exon 2, 277-279TGG>TGA, causes W61X, a premature stop at codon 61 | Tissue Antigens (2014) 84:497-502 |
DQB1*06:75N | Point | Exon 2, 274-276TAC>TAG, causes Y60X, a premature stop at codon 60 | Tissue Antigens (2014) 84:497-502 |
DQB1*06:77N | Point | Exon 2, 253-255CAG>TAG, causes Q53X, a premature stop at codon 53 | |
DQB1*06:102N | Point | Exon 3, 487-489TGG>TAG, causes W131X, a premature stop at codon 131 | HLA (2017) 90:171-173 |
DQB1*06:112N | Point | Exon 2, 124-126CAG>TAG, causes Q10X, a premature stop at codon 10 | HLA (2017) 90:171-173 |
DQB1*06:144N | Point | Exon 2, 205-207TAC>TAA, causes Y37X, a premature stop at codon 37 | |
DQB1*06:158N | Point | Exon 2, 196-198CGA>TGA causes R34X, a premature stop at codon 34 | |
DQB1*06:179N | Point | Exon 2, 196-198CGA>TGA, causes R34X, a premature stop at codon 34 | |
DQB1*06:193N | Point | Exon 2, 277-279TGG>TAG, causes Y61X, a premature stop at codon 61 | |
DQB1*06:216N | Point | Exon 2, 655G>T, causes E187X, a premature stop at codon 187 | |
DQB1*06:252N | Deletion | Exon 2, 139delT, in codon 15, causes frameshift and premature stop in codon 27 | |
DQB1*06:303N | Deletion | Exon 2, 265-271delGTTGCCG, in codon 57, causes frameshift and premature stop at codon 97 | |
DQB1*06:304N | Deletion | Exon 3, 535delC, in codon 147, causes frameshift and premature stop at codon 159 | |
DQB1*06:306N | Insertion | Exon 2, 313insG, in codon 73, causes framshift and premature stop at codon 135 | |
DQB1*06:308N | Deletion | Exon 3, 593delC, in codon 166, causes frameshift and premature stop at codon 200 | |
DQB1*06:317N | Point | Exon 4, 682C>T, causes X196, a premature stop at codon 196 | |
DQB1*06:330N | Deletion | Exon 3, 555delG, in codon 153, causes frameshift and premature stop in codon 153 | |
DQB1*06:341N | Point | Exon 2, 343-345TAC>TAG, causes Y83X, a premature stop in codon 83 | |
DQB1*06:345N | Point | Exon 2, 196-198CGA>TGA, causes R34X, a premature stop at codon 34 | |
DQB1*06:379N | Deletion | Exon 2, 129delT, in codon 11, causes a frameshift and premature stop in codon 27 | HLA (2020) 96:709-713 |
DQB1*06:383N | Deletion | Exon 2, 167-171delTGCGT in codon 24-25, causes a frameshift and premature stop at codon 31 | |
DQB1*06:394N | Point | Exon 3, 553-555TGG>TAA, causes X153, a premature stop at codon 153 | |
DQB1*06:397N | Point | Exon 3, 657-659TGG>TAG, causes X188, a premature stop at codon 188 | |
DQB1*06:414N | Deletion | Exon 3, 516delC, in codon 140, causes a frameshift and premature stop at codon 159 | |
DQB1*06:422N | Insertion | Exon 1, 54insTGTC in codon -14, causes frameshift and premature stop at codon 1 | HLA (2023) 102:192-205 |
DQB1*06:423N | Point | Exon 2, 370-372CAG>TAG, causes Q92X, a premature stop in codon 92 | HLA (2022) 100:186-188 |
DQB1*06:447N | Deletion | Exon 2, 232delG in codon 46, causes X50, a premature stop at codon 50 | |
DQB1*06:452N | Deletion | Exon 2 279delG in codon 61, causes a frameshift and premature stop at codon 61 | |
DQB1*06:454N | Point | Exon 3, 658-660TGG>TAG, causes X188, a premature stop at codon 188 | |
DQB1*06:456N | Deletion | Exon 2, 166delGTGCGGGGTGTGACCAGACACA in codon 24, causes a frameshift and premature stop at codon 43 | |
DQB1*06:458N | Insertion | Exon 3, 535insC in codon 147, causes a frameshift and premature stop at codon 149 | |
DQB1*06:477N | Point | Exon 2, 280-283TGG>TGA, causes X61, a remature stop at codon 61 | |
DQB1*06:491N | Point | Exon 3, 553-555TGG>TAG, cause X153, a premature stop at codon 153 | |
DQB1*06:507N | Deletion | Exon 3, 437delC in codon 114, causes a frameshift and preamture stop at codon 119 | |
DQB1*02:18N | Point | Exon 2, 277-279TGG>TGA, causes W61X, a premature stop at codon 61 | Tissue Antigens (2014) 84:497-502 |
DQB1*02:20:01:01N | Point | Exon 2, 376-378CGA>TGA, causes R94X, a premature stop at codon 94 | Tissue Antigens (2014) 84:497-502 |
DQB1*02:20:01:02N | Point | Exon 2, 376-378CGA>TGA, causes R94X, a premature stop at codon 94 | |
DQB1*02:58N | Point | Exon 2, 199-201GAA>TAA, causes E35X, a premature stop at codon 35 | |
DQB1*02:67N | Point | Exon 2, 142-144TAC>TAG, causes Y16X, a premature stop at codon 16 | |
DQB1*02:96N | Point | Exon 3, 449C>A, causes S118X, premature stop at codon 118 | |
DQB1*02:129N | Deletion | Exon 2, 126delG, in codon 10, causes a frameshift and premature stop at codon 27 | |
DQB1*02:132N | Deletion | Exon 2, 247delA, in codon 51, causes a frameshift and premature stop at codon 99 | |
DQB1*02:134N | Deletion | Exon 2, 320delT, in codon 75, causes a frameshift and premature stop at codon 99 | |
DQB1*02:162N | Point | Exon 2, 274-276TAC>TAG, causes Y60X, a premature stop in codon 60 | HLA (2021) 98:244-246 |
DQB1*02:163N | Point | Exon 1, 67-69, TCG>TAG, causes X-10, a premature stop at codon -10 | |
DQB1*02:167N | Insertion | Exon 2, 184-187insAGCA, in codon 31, causes frameshift and premature stop at codon 34 | |
DQB1*02:176N | Insertion | Exon 3, 535insC, in codon 147, causes a frameshift and premature stop in codon 149 | |
DQB1*02:177N | Point | Exon 2, 367-369TTG>TAG, causes L91X, a premature stop in codon 91 | |
DQB1*02:183N | Deletion | Exon 2, 279delG in codon 61, causes frameshift and premature stop at codon 61. | |
DQB1*02:194N | Point | Exon 2, 139>141TGC>TGA, causes C15X, a premature stop at codon 15 | |
DQB1*02:204N | Insertion | Exon 2, 362insCGACCTTGCA in codon 92, causes a frameshift and premature stop at codon 152 | |
DQB1*02:206N | Deletion | Exon 3, 535delC in codon 147, causes a frameshift and premature stop at codon 159 | |
DQB1*02:214N | Point | Exon 3, 683-685 CAG>TAG, causes X181, a premature stop at codon 181 | |
DQB1*02:221N | Deletion | Exon 2, 298delC in codon 67, causes a frameshift and premature stop at codon 99 | |
DQB1*02:230N | Insertion | Exon 3, 536insC in codon 147 causes a frameshift and premature stop at codon 149 | |
DQB1*03:01:01:21N | Point | Intron 3, g4627G>A, affecting splice site for exon 3, which is shown to cause lack of protein expression | HLA (2022) 99:160-166 |
DQB1*03:66N | Point | Exon 2, 277-279TGG>TAG, causes W61X, a premature stop at codon 61 | Tissue Antigens (2014) 84:497-502 |
DQB1*03:84N | Point | Exon 2, 622-624GAG>TAG, causes E176X, a premature stop at codon 176 | |
DQB1*03:90N | Deletion | Exon 2, 240delG, in codon 48, causes a premature stop codon at 50 | HLA (2017) 90:171-173 |
DQB1*03:95N | Deletion | Exon 2, 183delG, in codon 29, causes a premature stop codon at 50 | HLA (2017) 90:171-173 |
DQB1*03:118N | Point | Exon 2, 205-207TAC>TAA, causes Y37X, a premature stop at codon 37 | |
DQB1*03:213N | Point | Exon 2, 286-288CAG>TAG, causes Q64X, a premature stop at codon 64 | |
DQB1*03:237N | Point | Exon 2, 205-207TAC>TAA causes Y37X, a premature stop at codon 37 | |
DQB1*03:269N | Point | Exon 2, 196C>T, causes R34X, premature stop at codon 34 | HLA (2019) 95:128-130 |
DQB1*03:276N | Deletion | The allele contains sequence from intron 1 onwards, but has no preceding exon sequences | Human Immunology (2018) 79:491-493 |
DQB1*03:282N | Deletion | Exon 2, 258delG, in codon 54, causes frameshift and premature stop in codon 99 | HLA (2021) 98:408-410 |
DQB1*03:303N | Point | Exon 2, 301-303GAG>TAG, causes X69, a premature stop at codon 69 | |
DQB1*03:310N | Deletion | Exon 3, 525-531delGTCCACC, in codons 143-145, causes a frameshift and premature stop at codon 157 | |
DQB1*03:334N | Point | Exon 2, 121-123TAC>TAG, causes X9, a premature stop at codon 9 | HLA (2023) 101:507-512 |
DQB1*03:338N | Deletion | Exon 3, 535delC, in codon 147, causes a frameshift and premature stop at codon 159 | HLA (2023) 102:83-84 |
DQB1*03:339N | Insertion | Exon 2, 233insG, in codon 46, causes a frameshift and premature stop at codon 135 | |
DQB1*03:340N | Deletion | Exon 3, 566delT, in codon 157, causes a frameshift and premature stop at codon 159 | |
DQB1*03:354N | Deletion | Exon 2, 209-221delCACGCTTCGACAG, in codons 38-42, causes a frameshift and premature stop in codon 46 | |
DQB1*03:356N | Insertion | Exon 2, 222-226insGACAG, in codon 42, causes frameshift and premature stop in codon 52 | |
DQB1*03:357N | Deletion | Exon 2, 220delA, in codon 42, causes a frameshift and premature stop in codon 50 | |
DQB1*03:358N | Deletion | Exon 3, 634-661delCTCCAGAACCCCATCACCGTGGAGTGGC, in codons 180-189, causes a frameshift and premature stop in codon 191 | |
DQB1*03:375N | Point | Exon 3, 4445-447TGC>TGA, causes C117X, a premature stop in codon 117 | |
DQB1*03:376N | Point | Exon 3, 658-660TGG>TAG, causes W188X, a premature stop in codon 188 | |
DQB1*03:385N | Point | Exon 3, 592-594CAG>TAG, causes Q166X, a premature stop in codon 166 | |
DQB1*03:399N | Point | Exon 2, 346-348CAG>TAG, causes Q84X, a premature stop at codon 84 | |
DQB1*03:400N | Insertion | Exon 3, 353insC, in codon 147, causes a frameshift and a premature stop in codon 149 | HLA (2020) 96:749-750 |
DQB1*03:403N | Insertion | Exon 3, 583-589insTTTGTCT, in codon 165, causes frameshift and premature stop at codon 195 | |
DQB1*03:407N | Point | Exon 2, 121-123, TAC>TAG, causes X9, a premature stop at codon 9 | |
DQB1*03:411N | Deletion | Exon 2, 313delG in codon 73, causes frameshift and premature stop at codon 99 | |
DQB1*03:422N | Point | Exon 3, 637-639, CAG>TAG, causes X181, a premature stop at codon 181 | Human Immunology (2020) 81:202-205 |
DQB1*03:427N | Insertion | Exon 2, 236insGT, in codon 47, causes a frameshift and premature stop in codon 51. | |
DQB1*03:440N | Insertion | Exon 2, 327insT in codon 77, causes frameshift and premature stop at codon 135 | |
DQB1*03:473N | Point | Exon 2, 292-294GAA>TAA, causes X66, a premature stop at codon 66 | |
DQB1*03:488:01N | Point | Exon 2, 331-333TGC>TGA, causes X79, a premature stop at codon 79 | |
DQB1*03:488:02N | Point | Exon 2, 331-333TGC>TGA, causes X79, a premature stop at codon 79. A silent mutation after the premature stop | |
DQB1*03:499N | Point | Exon 2, 172-174TAT>TAA, causes X26, a premature stop at codon 26 | HLA (2023) 101:304-305 |
DQB1*03:509N | Deletion | Exon 3, 389delCA in codon 98, causes a frameshift and premature stop at codon 134 | HLA (2023) 101:707-708 |
DQB1*03:541N | Deletion | Exon 2, 339delACAACTA in codon 81, causes a frameshift and premature stop at | |
DQB1*03:542N | Point | Exon 3, 487-489TGG>TAG, causes X131 a premature stop at codon 131 | |
DQB1*03:551N | Deletion | Exon 2, 335delA in codon 80, causes a frameshift and premature stop at codon 99 | |
DQB1*03:560N | Insertion | Exon 2, 311insC in codon 72, causes a frameshift and premature stop at codon 135 | |
DQB1*04:25N | Point | Exon 2, 271-273GAG>TAG, causes E59X, a premature stop at codon 59 | HLA (2016) 87:31-35 |
DQB1*04:36N | Point | Exon 2, 376-378CGA>TGA, causes R94X, a premature stop at codon 94 | |
DQB1*04:41N | Point | Exon 3, 465T>G, causes Y123X, a premature stop at codon 123 | |
DQB1*04:46N | Point | Exon 3, 472-474CAG>TAG, causes X126, a premature stop in codon 126 | |
DQB1*04:59N | Deletion | Exon 3, 592delC, in codon 166, causes a frameshift and premature stop at codon 200 | HLA (2023) 101:195-196 |
DQB1*04:68N | Insertion | Exon 3, 406insT, in codon 104, causes frameshift and premature stop in codon 135 | |
DQB1*04:73N | Deletion | Exon 2, 247delA, in codon 51, causes a frameshift and premature stop in codon 99 | HLA (2021) 97:171-172 |
DQB2*01:10N | Point | Exon 1, 7-9TGG>TAG, causes X-30, a premature stop at codon -30 | |
DPA1*01:29N | Point | Exon 3, 454-456, TGG>TAG, causes X121, a premature stop at codon 121 | HLA (2020) 95:82-83 |
DPA1*01:32N | Point | Exon 2, 154-156GAG>TAG, causes E21X, a premature stop in codon 21 | |
DPA1*01:35N | Point | Exon 2, 316-318,CAG>TAG, causes X75, a premature stop at codon 75 | HLA (2020) 96:378-379 |
DPA1*01:55N | Deletion | Exon 3, 586delG in codon 165, causes frameshift and premature stop at codon 203 | |
DPA1*01:66N | Deletion | Exon 2, 302delT in codon 70, causes frameshift and premature stop at codon 70 | |
DPA1*01:79N | Insertion | Exon 2, 326insA in codon 78, causes frameshift and premature stop at codon 88 | |
DPA1*01:114N | Point | Exon 2, 241-243CAA>TAA, causes X50, a premature stop at codon 50 | |
DPA1*01:119N | Point | Exon 2, 334-336 CAG>TAG, causes X81, a premature stop at codon 81 | |
DPA1*01:120N | Point | Exon 262-264CAG>TAG, causes X57, a premature stop at codon 57 | |
DPA1*01:123N | Deletion | Exon 2, 146-163delCAACAGGGGAGTTTATG in codon 18, causes a frameshift and premature stop at codon 19 | |
DPA1*01:137N | Point | Exon 1, 79-81CGA>TGA, causes X-4, a premature stop at codon -4 | Frontiers in Genetics (2023) 14:- |
DPA1*01:147N | Point | Exon 2, 241-243CAA>TAA, causes X50, a premature stop at codon 50 | HLA (2023) 102:385-387 |
DPA1*01:154N | Deletion | Exon 2, 138-146delGCATAGAC in codon 15, causes a frameshift and premature stop at codon 22 | |
DPA1*01:168N | Deletion | Exon 3, 420delT in codon 109, causes a frameshift and premature stop at codon 151 | |
DPA1*01:217N | Point | Exon 2, 112-114TCA>TGA, causes X7, a premature stop at codon 7 | |
DPA1*01:219N | Deletion | Exon 3, 393delG in codon 100, causes a frameshift and premature stop at codon 151 | |
DPA1*02:13N | Point | Exon 4, 628-630GAG>TAG, causes X179, a premature stop at codon 179 | |
DPA1*02:32N | Deletion | Exon 3, 369delT in codon 92, causes frameshift and premature stop at codon 151. | Human Immunology (2020) 81:202-205 |
DPA1*02:41N | Point | Exon 3, 628-670GAG>TAG, in codon 179, causes E179X, a premature stop in codon 179 | |
DPA1*02:52N | Point | Exon 2, 220-222TGG>TGA, causes W43X, a premature stop in codon 43 | |
DPA1*02:66:01N | Point | Exon 2, 241-243CGA>TGA, causes X50, a premature stop at codon 50 | |
DPA1*02:66:02N | Point | Exon 2, 241-243 CGA>TGA, causes X50, a premature stop at codon 50 | Human Immunology (2023) 84:296-300 |
DPA1*02:74N | Deletion | Exon 2, 330delC, in codon 79, causing a frameshift and premature stop in codon 89 | |
DPA1*02:80N | Insertion | Exon 2, 181insGC in codon 30, causes a frameshift and premature stop at codon 67 | |
DPA1*02:94N | Point | Exon 2, 334-336CAG>TAG, causes X81, a premature stop at codon 81 | |
DPA1*02:108N | Insertion | Exon 2, 192insCTAT in codon 33, causes a frameshift and premature stop at codon 39 | |
DPA1*02:133N | Point | Exon 2, 316-318 CAG>TAG, causes X75, a premature stop at codon 75 | |
DPA1*02:140N | Point | Exon 1, 79-81CGA>TGA, causes X-4, a premature stop at codon -4 | HLA (2024) 104:- |
DPA1*02:147N | Insertion | Exon 3, 365insG in codon 91, causes a frameshift and premature stop at codon 110 | |
DPA1*02:148N | Point | Exon 2, 133-135CAG>TAG, causes X14, a premature stop at codon 14 | |
DPA1*03:10N | Point | Exon 2, 175-177GAA>TAA, causes X28, a premature stop at codon 28 | |
DPA1*03:11N | Insertion | Exon 4, 632insAGAGC, causes a frameshift and premature stop in codon 205 | |
DPA1*03:19N | Point | Exon 2, 232-234GAG>TAG, causes X47, a premature stop at codon 47 | |
DPB1*04:01:01:24N | Point | Intron 2, g5163G>T, affecting splicing site for exon 2 | |
DPB1*61:01N | Point | Exon 2, 286-288GAG>TAG, causes E67X, a premature stop at codon 67 | Tissue Antigens (1996) 47:293-299 |
DPB1*64:01N | Point | Exon 2, 106-108TAC>TAA, causes Y7X, a premature stop at codon 7 |
Tissue Antigens (1997) 49:262-266 HLA (2018) 92:426-427 |
DPB1*120:01N | Point | Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10 | |
DPB1*154:01N | Point | Exon 2, 271-273CAG>TAG, causes Q62X, a premature stop at codon 62 | |
DPB1*159:01N | Point | Exon 2, 361-363CGA>TGA, causes R92X, a premature stop at codon 92 | |
DPB1*161:01N | Point | Exon 2, 340-342GAG>TAG, causes E85X, a premature stop at codon 85 | |
DPB1*216:01N | Point | Exon 2, 319-321AGA>TGA, causes R78X, a premature stop at codon 78 | HLA (2016) 87:31-35 |
DPB1*218:01N | Point | Exon 2, 151-153CAG>TAG, causes Q22X, a premature stop at codon 22 | |
DPB1*328:01N | Point | Exon 2, 361-363CGA>TGA, causes R92X, a premature stop at codon 92 | |
DPB1*357:01N | Point | Exon 2, 328-330TAC>TAG, causes Y81X, a premature stop at codon 81 | HLA (2016) 87:31-35 |
DPB1*382:01N | Point | Exon 2, 166-168AGA>TGA, causes R27X, a premature stop at codon 27 | |
DPB1*401:01:01N | Point | Exon 2, 328-330TAC>TAG, causes Y81X, a premature stop at codon 81 | |
DPB1*401:01:02N | Point | Exon 2, 328-330TAG>TAA, causes X81, a premature stop at codon 81. | |
DPB1*403:01N | Point | Exon 2, 262-264TGG>TGA, causes W59X, a premature stop at codon 59 | |
DPB1*450:01N | Point | Exon 2, 124-126CAG>TAG, causes Q13X, a premature stop at codon 13 | |
DPB1*455:01N | Point | Exon 2, 355-357CAG>TAG, causes Q90X, a premature stop at codon 90 | |
DPB1*507:01N | Point | Exon 2, 340-342GAG>TAG, causes E85X, a premature stop at codon 85 | |
DPB1*551:01N | Point | Exon 2, 262-264TGG>TGA, causes W59X, a premature stop at codon 59 | |
DPB1*570:01N | Point | Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10 | |
DPB1*598:01N | Point | Exon 2, 151-153CAG>TAG, causes Q22X, a premature stop at codon 22 | |
DPB1*657:01N | Point | Exon 2, 330TAC>TAA, causes Y81X, a premature stop at codon 81 | |
DPB1*661:01N | Point | Exon 2, 166C>A, causes R27X, a premature stop at codon 27 | |
DPB1*691:01N | Point | Exon 2, 184G>T, causes E33X a premature stop at codon 33 | |
DPB1*693:01N | Deletion | Exon 2, 184delG, in codon 33, causes frameshift and premature stop at codon 48 | |
DPB1*696:01N | Deletion | Exon 2, 132-133delCT, in codons 14-15, causes frameshift and premature stop in codon 15 | |
DPB1*700:01N | Point | Exon 3, 490-492GAG>TAG, causes E135X, a premature stop in codon 135 | HLA (2022) 99:152-153 |
DPB1*712:01N | Point | Exon 2, 319-321AGA>TGA, causes X78, a premature stop in codon 78 | |
DPB1*724:01N | Point | Exon 3, 469-471CGA>TGA, causes R128X, a premature stop in codon 128 | |
DPB1*732:01N | Point | Exon 2, 469-471CGA>TGA, causes X128, a premature stop in codon 128 | |
DPB1*738:01N | Deletion | Exon 2, 243delG, in codon 52, causes frameshift and premature stop in codon 87 | |
DPB1*743:01N | Point | Exon 2, 262-264TGG>TAG, causes X59, a premature stop in codon 59 | |
DPB1*748:01N | Point | Exon 2, 259-261TAC>TAG, causes X58, a premature stop in codon 58 | |
DPB1*754:01N | Point | Exon 2, 409-411CAG>TAG, causes X108, a premature stop in codon 108 | |
DPB1*756:01N | Point | Exon 2, 469-471CGA>TGA, causes X128, a premature stopn in codon 128 | |
DPB1*777:01N | Point | Exon 2, 487-489CAG>TAG, causes X134, a premature stop at codon 134 | |
DPB1*786:01:01N | Point | Exon 2, 473-474TGG>TAG, causes W129X, a premature stop at X129 | |
DPB1*786:01:02N | Point | Exon 2, 474-476TGG>TAG, causes W129X, a premature stop at codon 129 | |
DPB1*792:01N | Point | Exon 2, 645-647TGG>TAG, causes W186X, a premature stop at 186 | |
DPB1*794:01N | Point | Exon 2, 580-582CAG>TAG, causes X165, a premature stop at 165 | |
DPB1*800:01N | Point | Exon 2, 577-579CAG>TAG, causes Q164X, a premature stop at 164 | |
DPB1*821:01N | Point | Exon 1, 330-332TAC>TAA, causes X81, a premature stop at 81 | |
DPB1*831:01N | Point | Exon 1, 289-291GAG>TAG, causes X68, a premature stop at codon 68 | |
DPB1*838:01N | Point | Exon 1, 171-173TAC>TAG, causes X28, a premature stop at codon 28 | |
DPB1*844:01N | Point | Exon 1, 286-288GAG>TAG, causes X67, a premature stop at codon 67 | |
DPB1*862:01N | Point | Exon 2, 474-476TGG>TGA, causes X129, a premature stop at codon 129 | |
DPB1*865:01N | Deletion | Exon 2, 342delG, in codon 85, causes a frameshift and premature stop in codon 87 | |
DPB1*866:01N | Deletion | Exon 3, 402delG, in codon 105, causes a frameshift and premature stop in codon 117 | |
DPB1*867:01N | Insertion | Exon 2, 196insA, in codon 37, causes a frameshift and premature stop in codon 106 | |
DPB1*868:01N | Deletion | Exon 2, 171delC, in codon 28, causes a frameshift and premature stop in codon 28 | |
DPB1*869:01N | Deletion | Exon 2, 205delA, in codon 40, causes a frameshift and premature stop in codon 48 | |
DPB1*870:01N | Deletion | Exon 2, 171delC, in codon 28, causes a frameshift and premature stop in codon 28 | |
DPB1*871:01N | Insertion | Exon 2, 265insG, in codon 60, causes a frameshift and premature stop in codon 96 | |
DPB1*872:01N | Insertion | Exon 2, 171insA, in codon 28, causes a frameshift and premature stop in codon 28 | |
DPB1*873:01N | Deletion | Exon 2, 264delG, in codon 59, causes a frameshift and premature stop in codon 59 | |
DPB1*874:01N | Deletion | Exon 2, 298delG, in codon 71, causes a frameshift and premature stop in codon 87 | |
DPB1*875:01N | Deletion | Exon 2, 107delA, in codon 7, causes a frameshift and premature stop in codon 48. | |
DPB1*876:01N | Insertion | Exon 3, 403insG, in codon 106, causes a frameshift and a premature stop in codon 148 | |
DPB1*877:01N | Point | Exon 2, 262-264TGG>TGA, causes X59, a premature stop in codon 59 | |
DPB1*878:01N | Insertion | Exon 3, 391insC, in codon 102, causes frameshift and premature stop in codon 148 | |
DPB1*894:01N | Deletion | Exon 3, 471delA, in codon 128, causes a frameshift and premature stop in codon 131 | |
DPB1*911:01N | Point | Exon 2, 112-114TTC>TAA, causes X9, a premature stop at codon 9 | |
DPB1*917:01N | Deletion | Exon 2, 192-199delCGTGCGCT, in codons 35-38, causes a frameshift and premature stop at codon 52 | |
DPB1*919:01N | Insertion | Exon 2, 136-139insCTAC, in codon 17, causes a frameshift and premature stop at codon 20 | |
DPB1*925:01N | Insertion | Exon 3, 415-416insAC, in codon 110, causes a frameshift and premature stop at codon 118 | |
DPB1*941:01N | Insertion | Exon 2, 346insC, in codon 87, causes frameshift and premature stop at codon 96 | |
DPB1*950:01N | Point | Exon 3, 409-411CAG>TAG, causes Q108X, a premature stop in codon 108 | |
DPB1*959:01N | Point | Exon 2, 261C>G, causes X58, a premature stop at codon 58 | |
DPB1*960:01N | Deletion | Exon 2, 295delC, in codon 70, causes a frameshift and premature stop in codon 87 | |
DPB1*974:01N | Insertion | Exon 3, 577insC in codon 164, causes frameshift and premature stop in codon 180 | |
DPB1*984:01N | Deletion | Exon 2, 277delG in codon 64, causes a frameshift and premature stop in codon 87 | |
DPB1*985:01N | Point | Exon 3, 367-369CAG>TAG, causes Q94X, a premature stop in codon 94 | |
DPB1*986:01N | Insertion | Exon 3, 403insG, in codon 106, causes frameshift and premature stop in codon 14 | |
DPB1*995:01N | Deletion | Exon 2, 346-352delATGACCC, in codons 87-89, causes frameshift and premature stop in codon 95 | HLA (2023) 101:507-512 |
DPB1*1029:01N | Deletion | Exon 2, 256delG, in codon 57, causes frameshift and premature stop at codon 87 | |
DPB1*1041:01N | Point | Exon 2, 163-165, GAG>TAG, causes X26, a premature stop at codon 26 | |
DPB1*1044:01N | Point | Exon 2, 316-218, TGC>TGA, causes X77, a premature stop at codon 77 | |
DPB1*1045:01N | Point | Exon 2, 340-342, GAG>TAG, causes X85, a premature stop at codon 85 | |
DPB1*1070:01N | Deletion | Exon 2, 335delT, in codon 83, causes frameshift and premature stop at codon 87 | |
DPB1*1079:01N | Point | Exon 2, 175-177TAC>TAA, causes X30, a premature stop at codon 30 | |
DPB1*1084:01N | Insertion | Exon 2, 189insG, in codon 35, causes a frameshift and premature stop in codon 55 | |
DPB1*1098:01N | Point | Exon 3, 469-471, CGA>TGA, causes X128, a premature stop at codon 128. | HLA (2020) 96:249-251 |
DPB1*1112:01N | Insertion | Exon 3, 619insA in codon 178, causes frameshift and premature stop at codon 180 | |
DPB1*1121:01N | Point | Exon 2, 361-363CGA>TGA, causes R92X, a premature stop in codon 92 | |
DPB1*1135:01N | Insertion | Exon 2, 286insG, in codon 67, causes a frameshift and premature stop in codon 96 | |
DPB1*1154:01N | Deletion | Exon 2, 248delC in codon 54, causes frameshift and premature stop at codon 87 | |
DPB1*1169:01N | Deletion | Exon 2, 145delT, in codon 19, causes a frameshift and premature stop at codon 48 | |
DPB1*1191:01N | Insertion | Exon 2, 217insG in codon 44, causes frameshift and premature stop at codon 55 | |
DPB1*1193:01N | Deletion | Exon 2, 342delG, in codon 85, causes a frameshift and premature stop in codon 87 | |
DPB1*1202:01N | Point | Exon 3, 583-585GGA>TGA, causes X166, a premature stop at codon 166 | |
DPB1*1228:01N | Deletion | Exon 2, 187delG, in codon 34, causes a frameshift and premature stop in codon 48 | |
DPB1*1256:01N | Point | Exon 3, 469-471CGA>TGA causes X128, causes a premature stop at codon 128 | |
DPB1*1260:01N | Point | Exon 3, 487-490CAG>TAG, causes X134, a premature stop at codon 134 | |
DPB1*1269:01N | Deletion | Exon 3, 488delA, in codon 134, cause a frameshift and premature stop in codon 145 | |
DPB1*1275:01N | Point | Exon 3, 580-583CAG>TAG, causes X165, a premature stop at codon 165 | |
DPB1*1279:01N | Point | Exon 2, 187-189GAG>TAG, causes E34X, a premature stop in codon 34 | |
DPB1*1285:01N | Insertion | Exon 2, 107insA, in codon 7, causes a frameshift and premature stop in codon 7. | |
DPB1*1288:01N | Deletion | Exon 2, 137-139delCG in codon 17, causes X18, a frameshift and premature stop at codon 18 | |
DPB1*1291:01N | Point | Exon 2, 331-333GAG>TAG, causes E82X, a premature stop in codon 82 | |
DPB1*1299:01N | Insertion | Exon 2, 256insG in codon 57, causes a frameshift and premature stop at codon 96 | HLA (2023) 102:388-390 |
DPB1*1325:01N | Deletion | Exon 3, 642-647delGTGGA, causes a frameshift and premature stop in codon 189 | |
DPB1*1332:01N | Point | Exon 3, 643-645TGG>TGA, causes X186, a premature stop at codon 186 | |
DPB1*1334:01N | Deletion | Exon 2, 280delA in codon 65, causes a frameshift and premature stop at codon 87 | |
DPB1*1338:01N | Insertion | Exon 2, 345insC in codon87, causes a frameshift and premature stop at codon 96 | |
DPB1*1350:01N | Point | Exon 2, 331-333GAG>TAG, causes X82, a premature stop at codon 82 | |
DPB1*1357:01N | Point | Exon 2, 271-273CAG>TAG, causes Q62X, a premature stop in codon 62 | |
DPB1*1364:01N | Deletion | Exon 3, 411delG in codon 108, causes a frameshift and premature stop at codon 117 | |
DPB1*1375:01N | Deletion | Exon 3, 577delC in codon 164, causes a frameshift and premature stop at codon 198 | |
DPB1*1398:01N | Insertion | Exon 2, 279insGTACTGGAACAGCCAGAAGGAC, in codon 64, causes a frameshift and premature stop at codon 103 | |
DPB1*1415:01N | Insertion | Exon 3, 410insA in codon 107, causes a frameshift and premature stop at codon 148 | |
DPB1*1416:01N | Point | Exon 3, 538-540TGG>TGA, causes X151, a premature stop at codon 151 | |
DPB1*1423:01N | Insertion | Exon 2, 263insACTG in codon 59, causes a frameshift and premature stop at codon 59 | |
DPB1*1430:01N | Deletion | Exon 3, 462delTC in codon 125, causes a frameshift and premature stop at codon 147 | |
DPB1*1439:01N | Deletion | Exon 3, 406delC in codon 106, causes a frameshift and premature stop at codon 117 | |
DPB1*1440:01N | Point | Exon 3, 577-579CAG>TAG, causes X164, a premature stop at codon 164 | |
DPB1*1442:01N | Deletion | Exon 2, 365delACCCTGCAGCGCCGAG in codon 87, causes a frameshift and premature stop at codon 92 | |
DPB1*1449:01N | Point | Exon 2, 361-363CGA>TGA, causes X92, a premature stop at codon 92 | HLA (2024) 103:- |
DPB1*1455:01N | Deletion | Exon 3, 507delC, in codon 140, causes a frameshift and premature stop in codon 145 | HLA (2023) 102:390-391 |
DPB1*1463:01N | Point | Exon 3, 469-471 CGA>TGA, causes X128, a premature stop at codon 128 | HLA (2023) 102:393-395 |
DPB1*1478:01N | Insertion | Exon 2, 257insG in codon 57, causes a frameshift and premature stop at codon 96 | |
DPB1*1482:01N | Point | Exon 3, 469-471CGA>TGA causes X128, a premature stop at codon 128 | |
DPB1*1487:01N | Deletion | Exon 3, 575delC in codon 163, cause a frameshift and premature stop at codon 198 | |
DPB1*1488:01N | Insertion | Exon 2, 218insG in codon 44, causes a frameshift and premature stop at codon 55 | |
DPB1*1500:01N | Point | Exon 3, 469-471CGA>TGA, causes R128X, a premature stop in codon 128 | HLA (2024) 103:- |
DPB1*1512:01N | Deletion | Exon 3, 499delAGCTG, causes a frameshift and premature stop in codon 146 | |
DPB1*1517:01N | Point | Exon 2, 329-331TAC>TAG, causes X80, a premature stop at codon 81 | |
DPB1*1526:01N | Insertion | Exon 2, 212insAC in codon 42, causes a frameshift and premature stop at codon 49 | |
DPB1*1538:01N | Deletion | Exon 2, 281delC in codon 65, causes a frameshift and premature stop at codon 87 | |
DPB1*1542:01N | Point | Exon 3, 577-579CAG>TAG, causes X164, a premature stop at codon 164 | |
DPB1*1548:01N | Point | Exon 3, 487-489CAG>TAG, causes X134, a premature stop at codon 134 | |
DPB1*1581:01N | Point | Exon 3, 643-645TCG>TAG, causes X186, a premature stop at codon 186. | |
DPB1*1588:01N | Point | Exon 2, 118-119TTA>TAA, causes X11, a premature stop at codon 11 | |
DPB1*1607:01N | Point | Exon 3, 406-408TTG>TAG, causes X107, a premature stop at codon 107 | |
DPB1*1612:01N | Deletion | Exon 2, 362delC in codon 92, causes a frameshift and premature stop at codon 97 | |
DPB1*1645:01N | Deletion | Exon 2, 239delC in codon 51, causes a frameshift and premature stop at codon 87 | |
DPB1*1650:01N | Point | Exon 2, 271-273CAG>TAG, causes X62, a premature stop at codon 62 | |
DPB1*1660:01N | Deletion | Exon 2, 245delC in codon 53, causes a frameshift and premature stop at codon 87 | |
DPB1*1661:01N | Insertion | Exon 3, 578insC in codon 164, causes a frameshift and premature stop at codon 180 | |
DPB1*1662:01N | Point | Exon 2, 259-261TAC>TAG, causes X58, a premature stop at codon 58 | |
DPB1*1663:01N | Insertion | Exon 3, 589insAT in codon 167, causes X199, a premature stop at codon 199 | |
DPB1*1667:01N | Point | Exon 4, 487-489CAG>TAG, causes X134, a premature stop at codon 134 | |
DPB1*1677:01N | Point | Exon 3, 577-579CAG>TAG, causes X164, a premature stop at codon 164 | |
DPB1*1686:01N | Deletion | Exon 3, 402delC in codon 105, causes a frameshift and premature stop at codon 117 | |
DPB1*1713:01N | Deletion | Exon 3, 526delC in codon 147, causes a frameshift and premature stop at codon 157 | |
DPB1*1728:01N | Point | Exon 3, 472-474TGG>TAG, causes X129, a premature stop at codon 129 | |
DOA*01:04N | Deletion | Exon 2, 108delC, in codon 11, causes frameshift and premature stop at codon 37 | Tissue Antigens (2005) 66:242-245 |
DOB*01:18N | Deletion | Exon 3, 515delG in codon 146, causes a frameshift and premature stop at codon 159 | |
MICA*063N | Point | Exon 2, 184-186CAG>TAG, causes Q39X, a premature stop at codon 39 | Tissue Antigens (2011) 78:297-298 |
MICA*064N | Point | Exon 4, 799-801TGG>TGA, causes W244X, a premature stop at codon 244 | Tissue Antigens (2012) 79:313-314 |
MICA*088N | Point | Exon 4, 754-756CAG>TAG, causes Q229X, a premature stop at codon 229 | HLA (2019) 94:400-401 |
MICA*096N | Deletion | Exon 2, 78-79delCA, in codons 4-5, causes frameshift and premature stop at codon 7 | |
MICA*107N | Deletion | Exon 2, 146-147delTA, in codon 26, causes frameshift and premature stop at codon 36 | |
MICA*195N | Point | Exon 3, 577-579CGA>TGA, causes X170, a premature stop at codon 170 | |
MICA*222N | Point | Exon 4, 844-846TGC>TGA, causes X259, a premature stop at codon 259 | |
MICA*286N | Point | Exon 3, 577-579CGA>TGA, causes X170, a premature stop at codon 170 | |
MICA*293N | Point | Exon 3, 427-429CAA>TAA, causes X120, a premature stop at codon 120 | |
MICB*009:01:01N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | Immunogenetics (1997) 46:499-508 |
MICB*009:01:02N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:03N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:04N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:05N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:06N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:07N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:08N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:09N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:10N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:11N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:12N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:13N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:14N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*009:01:15N | Point | Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | |
MICB*021:01:01N | Deletion | Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 | Tissue Antigens (2004) 64:276-280 |
MICB*021:01:02N | Deletion | Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 | |
MICB*021:01:03N | Deletion | Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 | |
MICB*021:01:04N | Deletion | Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 | |
MICB*021:01:05N | Deletion | Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 | |
MICB*021:01:06N | Deletion | Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 | |
MICB*021:01:07N | Deletion | Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 | |
MICB*041N | Deletion | Exon 3, 596delT in codon 176, causes frameshift and premature stop at codon 186 | |
MICB*043N | Deletion | Exon 2, 300delG in codon 77, causes frameshift and premature stop at codon 140 | |
MICB*045N | Point | Exon 4, 955-957TGT>TGA, causes C296X, a premature stop in codon 296 | |
TAP1*01:02N | Deletion | Exon, 599delG, in codon 200, causes frameshift and premature stop at codon 228 | Journal of Clinical Investigation (1999) 103:755-758 |
Allele | Mutation | Description of Mutation | References |
---|---|---|---|
A*01:01:38L | Point | Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which results in low expression | Human Immunology (2011) 72:717-722 |
A*01:147Q | Point | Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*01:159Q | Point | Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*01:208Q | Point | Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | HLA (2017) 90:79-87 |
A*01:228Q | Deletion | Exon 3, 388-393delGACGGG, causes deletion of codons 106-107 | HLA (2017) 90:79-87 |
A*01:248Q | Deletion | Exon 7, 1085-1086delCT, in codon 338, causes frameshift and premature stop at codon 339, which may affect expression | |
A*01:281Q | Point | Exon 1, 1-3ATG>ATT, causes a non-synonymous change to the start codon, which may affect expression | |
A*01:301Q | Point | Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3 | HLA (2023) 101:507-512 |
A*01:396Q | Point | Exon 3, 562T>A, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*01:436Q | Point | Exon 5, 908-910CAG>TAG, causes X278, a premature stop at codon 278 | |
A*01:473Q | Point | Exon 1, 1-3ATG>GTG, causes a non-synonymous change to the start codon, which may affect expression | |
A*01:476Q | Point | Exon 5, 993-995TGG>TAG, causes X308, a premature stop at codon 308 | |
A*02:01:01:02L | Point | Promoter Region, g-101T>C, causes a mutation in the Enhancer B region of the promoter |
Human Immunology (1994) 41:69-73 Tissue Antigens (2006) 68:442-445 |
A*02:01:01:134Q | Point | Intron 2, g475T>C, causes a mutation in the splice site proceeding exon 2, which may affect expression. | |
A*02:01:01:252Q | Point | Intron 6, g2681G>A in the splice site preceding exon 7, which may affect expression. | |
A*02:01:14Q | Point | Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expression | HLA (2018) 91:175-186 |
A*02:03:01:06Q | Point | Intron 3, g991G>T in the splice site proceeding exon 3 which may affect expression | HLA (2024) 104:- |
A*02:03:12Q | Point | Exon 4, 703-705GCG>GCA, potentially causing an aberrant dominant splice site which may result in low expression | |
A*02:293Q | Point | Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | Tissue Antigens (2011) 78:267-270 |
A*02:437Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*02:440Q | Point | Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*02:500Q | Point | Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*02:581Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*02:605Q | Point | Exon 3, 373-375TGC>TGG, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*02:618Q | Deletion | Exon 3, 520-531delGCCCATGTGGCG, a deletion of codons 150-153, which may affect expression | |
A*02:672Q | Point | Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression |
HLA (2019) 94:59-60 HLA (2023) 102:609-610 |
A*02:728Q | Point | Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*02:795Q | Point | Exon 1, 1-3ATG>TTG, causes a non-synonymous change to the start codon, which may affect expression | |
A*02:805Q | Deletion | Exon 2, 288-290delGAC, causes deletion of codon 73, which may affect expression | |
A*02:826Q | Deletion | Exon 2, 214-222delCGGGCGCCG, causes deletion of codons 48-50, which may affect expression | |
A*02:827Q | Deletion | Exon 2, 149-157delGCTACGTGG, causes deletion of codons 26-28, which may affect expression | |
A*02:997Q | Point | Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | HLA (2023) 102:343-347 |
A*02:1007Q | Point | Exon 6, 1030-1032TAC>TAG, causes Y320X, a premature stop in codon 320 | |
A*02:1011Q | Point | Exon 1, 1-3ATG>GTG, causes a non-synonymouse change to the start codon, which may change expression | |
A*02:1041Q | Point | Exon 3, 562-564TGC>TAC, causes C164Y, affecting the disulphide bond, and may affect expression | HLA (2024) 103:- |
A*02:1045Q | Point | Exon 3, 373-375TGC>TAG, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*02:1052Q | Point | Exon 3, 373-375TGC>AGC, causes C101S, which disrupts the disulphide bond and may affect expression | |
A*02:1064Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*02:1068Q | Point | Exon 1, 1-3ATG>AGG, causes M>R, this change affects the start codon, which may affect expression | HLA (2023) 101:271-272 |
A*03:01:96Q | Point | Exon 4, 703-705GCG>GCA, potentially causing an aberrant dominant splice site which may result in low expression | |
A*03:234Q | Deletion | Exon 3, 520-531delGAGGCGGCCCAT, a deletion of codons 150-153, which may affect expression | |
A*03:388Q | Insertion | Exon 3, 438-440insTTA, causes insertion of codon 124, which may affect expression | |
A*03:437Q | Point | A*03 novel allele with a mutation in the stop codon, novel allele with mutation in stop codon, resulting in extension of CDS sequence by 24bp/8aa | |
A*03:458Q | Point | Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression | |
A*03:461Q | Point | Exon 3, 562-564TGC>TAC, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*03:464Q | Point | Intron 2, g475G>C causes a mutation in the splice site proceeding exon 2, which may affect expression | |
A*03:492Q | Deletion | Exon 3, 449delCTGAAC causes 125-126delLN, which may affect expression | |
A*03:501Q | Deletion | Exon 2, 140delATCGCCGTGGGC causes 22-25delIAVG, which may affect expression | |
A*11:01:98Q | Point | Exon 4, 703-705GCG>GCA, potentially causing an aberrant dominant splice site which may result in low expression | |
A*11:50Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*11:52Q | Deletion | Exon 2, 103-105delTCC, causes deletion of codon 11, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | Tissue Antigens (2011) 78:195-202 |
A*11:170Q | Point | Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | HLA (2017) 90:171-173 |
A*11:182Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*11:235Q | Deletion | Exon 2, 118-123delGGCCGC, causes deletion of codons 16-17, which may affect expression | HLA (2016) 87:456-458 |
A*11:256Q | Deletion | Exon 3, 409-417delTACCGGCAG, causes deletion of codons 113-115 | HLA (2017) 89:302-304 |
A*11:272Q | Deletion | Exon 2, 167-175delCAGTTCGTG, causes the deletion of codons 32-34 | |
A*11:313Q | Deletion | Exon 1, 30-32delCCT, causes deletion of codon -15, which may affect expression | |
A*11:351Q | Insertion | Exon 3, 595-603insCTGGAGAAC, causes insertion of codons 175-177, which may affect expression | |
A*11:375Q | Point | Cysteine at 101 changed to Serine. Disulphide bond disrupted and this may affect expression. | |
A*11:447Q | Point | Exon 5, 994-996TGG>TGA, causes W308X, a premature stop in the transmembrane domain, which may affect expression | |
A*23:107Q | Point | Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*24:02:01:02L | Point | Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3 |
Journal of Immunology (1997) 158:5242-5250 Tissue Antigens (1997) 50:340-346 Transplantation (1999) 67:1336-1341 Tissue Antigens (2004) 63:589-591 |
A*24:02:01:17Q | Point | Intron 7, g2897A>C, causes a mutation in the splice site prior to exon 8, which may affect expression | |
A*24:02:01:144Q | Point | Intron 4, g1947G>A, affecting splice site for exon 5, which may affect expression. | |
A*24:02:03Q | Point | Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expression | Tissue Antigens (2003) 61:325-329 |
A*24:02:158Q | Point | Intron 2, 235G>A in the splice site preceding exon 3, which may affect expression | |
A*24:294Q | Deletion | Exon 2, 325-327delTAC, a deletion of codon 85, which may affect expression | |
A*24:329Q | Point | Exon 3, 373-375TGC>CGC, causes C101R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | HLA (2019) 95:128-130 |
A*24:378Q | Point | Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*24:447Q | Point | Intron 2, g475T>C, causes a mutation in the splice site proceeding exon 2 | |
A*24:450Q | Point | Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3 | |
A*24:473Q | Insertion | Exon 1, 57insGCCCTG, causes insertion of codons -6 and -5, which may affect expression | |
A*24:479Q | Point | Exon 1, 1-3ATG>AAG, causes M>K, this change affects the start codon, which may affect expression | |
A*24:513Q | Point | Exon 5, 1009-1010C>A, causes Y313X, a premature stop in codon 313 | |
A*24:536Q | Deletion | Exon 2, 232-235delCAG, causes the deletion of codon 55, which may affect expression | |
A*26:01:01:52Q | Point | Intron 1, g74G>A, causes a mutation in the splice site proceeding exon 1, which may affect expression | |
A*26:251Q | Point | Exon 3, 562-564TGC>TTC, causes F164, which may affect expression | |
A*29:126Q | Insertion | Exon 3, 491-532insTGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTG, in codon 154, which may affect expression | |
A*29:175Q | Deletion | Exon 4, 971-986delGAGCTGTGGTCGCTG, causes 301-305delGAVVA, which may affect expression | |
A*30:02:25Q | Point | Exon 4, 703-705GCG>GCA, potentially causing an aberrant dominant splice site which may result in low expression | |
A*30:14L | Point | Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | Human Immunology (2006) 67:589-596 |
A*30:101Q | Point | Exon 3, 373-375TGC>TGG, causes C101R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*30:184Q | Insertion | Exon 3, 417insTTC causes 116insS which may affect expression | |
A*30:220Q | Deletion | Exon 1, 28delCCTCCTGCT, causes deletion of codons -14--12, which may affect | |
A*31:01:02:30Q | Point | Intron 7, g2730G>T, causes a mutation in the splice site proceeding exon 7, which may affect expression | |
A*31:01:02:51Q | Point | Intron 4, g1948G>T, in the acceptor splice site preceding exon 5, which may affect expression | |
A*31:151Q | Point | Exon 7, 1060-1062CAG>TAG, causes X330, a premature stop at codon 330, which may affect expression | |
A*31:206Q | Point | Exon 3, 563G>T, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*32:11Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression |
Tissue Antigens (2006) 68:518-520 Human Immunology (2018) 79:763-772 |
A*32:101Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*32:166Q | Deletion | Exon 2, 401-404delTCC, causes 111delL, which may affect expression | |
A*32:191Q | Point | Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression | |
A*33:03:01:21Q | Point | Intron 1, g75G>T, causes a mutation in the splice site proceeding exon 1, which may affect expression | |
A*33:03:03Q | Point | Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expression | Tissue Antigens (2009) 74:432-434 |
A*33:175Q | Deletion | Exon 2, 239-244delGGCCGG, causes the deletion of codons 56-57, which may affect expression | |
A*33:239Q | Deletion | Exon 4, 882-887delCACCCT, causes 271-272delTL, which may affect expression | |
A*33:273Q | Deletion | Exon 2, 218delGCGCCGTGG causes 48delAPW, which may affect expression | |
A*34:01:06Q | Point | Exon 4, 703-705GCG>GCA, potentially causing an aberrant dominant splice site which may result in low expression | |
A*66:26Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
A*68:01:59Q | Point | Exon 4, 703-705GCG>GCA, potentially causing an aberrant dominant splice site which may result in low expression | |
A*68:148Q | Point | Exon 3, 562-564TGC>AGC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | HLA (2017) 90:79-87 |
A*68:159Q | Deletion | Exon 2, 328-330delAAC, causes deletion of codon 86 | HLA (2017) 90:79-87 |
A*68:263Q | Insertion | Exon 4, 741insGAC, causes 224insD, which may affect expression | |
A*68:276Q | Deletion | Exon 3, 547delTAC, in codon 159, causes 159delY, which may affect expression | |
A*68:293Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
B*07:02:01:130Q | Point | Intron 3, g994T>C, affecting splice site for exon 3, which may affect expression. | |
B*07:360Q | Point | Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*07:426Q | Insertion | Exon 3, 478insinsAGGACCTGCGCTCCTGGACCGCCG in codons 136, causes insertion of EDLRSWTA, which may affect expression. | |
B*07:467Q | Point | Exon 3, 562-564TGC>TTC causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*08:270Q | Point | Exon 1, 1-3ATG>GTG, causes a non-synonymous change to the start codon, which may affect expression | |
B*08:284Q | Insertion | Exon 3, 491ins GGACACCGCGGC in codon 141, causes insertion of DTAA, which may affect expression. | |
B*08:300Q | Deletion | Exon 3, 473-485delCCGCGGCGGACA causes 138-141delDTAA, which may affect expression | |
B*08:323Q | Point | Cysteine at 101 changed to Serine. Disulphide bond disrupted and this may affect expression. | |
B*08:329Q | Deletion | Exon 3, 572delTGGCTCCGCAGATACCTGGAG, causes 166-172delWLRRYLE, which may affect expression | |
B*13:123Q | Point | B*13 novel allele with mutation in stop codon, resulting in extension of CDS sequence by 24bp/8aa | |
B*14:02:01:25Q | Point | Intron 3, g1566A>T in the splice site preceding exon 4, which may affect expression | |
B*14:70Q | Point | Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*14:108Q | Insertion | Exon 3, 494insCACCGCGGCTCA, in codon 141, causes insertion of HTAA, which may affect expression. | |
B*15:01:01:39Q | Point | Intron 1, g201G>C, causes a mutation in the splice site preceding exon 2, which may affect expression | |
B*15:01:01:65Q | Point | Intron 3, 993G>T in the splice site proceeding exon 3, which may affect expression | HLA (2023) 101:280-281 |
B*15:218Q | Point | Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | Tissue Antigens (2014) 83:184-189 |
B*15:245:01Q | Point | Exon 3, 562-564TGC>TTT, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*15:245:02Q | Point | Exon 3, 562-564TGC>TTT, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*15:321Q | Deletion | Exon 4, 742-753delCAAACTCAGGAC, a deletion of codons 224-227, which may affect expression | |
B*15:377Q | Deletion | Exon 2, 325-327delTAC, a deletion of codon 85, which may affect expression | HLA (2018) 92:304-309 |
B*15:520Q | Insertion | Exon 2, 328-330insTAC, causes the insertion of codon 86, which may affect expression | |
B*15:546Q | Deletion | Exon 1, 25-27delGTC, causes the deletion of codon -16, which may affect expression | |
B*15:616Q | Point | Intron 2, 473G>C causes a mutation in the splice site proceeding exon 2, which may affect expression | |
B*18:01:01:12Q | Point | Intron 2, g716G>C, causes a mutation in the splice site prior to exon 3, which may affect expression | |
B*18:01:01:42Q | Point | Intron 2, g715A>G, causes a mutation in the splice site prior to exon 3, which may affect expression. | |
B*18:106Q | Point | Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | HLA (2016) 87:31-35 |
B*18:231Q | Deletion | Exon 1, 50-53delTGG, causes -7delV, which may affect expression | |
B*27:05:02:04Q | Point | Intron 2, g716G>A, affecting splice site for exon 3, which may affect expression | HLA (2018) 91:187-194 |
B*27:185Q | Point | Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*27:253Q | Point | Intron 4, g1844G>T causes a mutation in the splice site proceeding exon 4, which may affect expression | |
B*35:65Q | Point | Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expression |
Immunogenetics (2006) 58:929-931 Immunogenetics (2006) 58:929-931 |
B*35:333Q | Point | Exon 3, 563G>A, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*35:428Q | Insertion | Exon 2, 143-157insAGCCCCGCTTCATCG, causes the insertion of codons 24-28, which may affect expression | |
B*35:460Q | Point | Not found to be expressed on cell surface | HLA (2021) 97:361-362 |
B*35:556Q | Point | Exon 3, 374G>A, causes C101Y, which disrupts the disulphide bond and may affect expression | |
B*37:16Q | Point | Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | Tissue Antigens (2014) 83:184-189 |
B*38:01:01:03Q | Deletion | Intron 2, g472delG, affecting splice site for exon 2, which may affect expression | |
B*38:55Q | Point | Exon 3, 373-375TGC>CGC, causes C101R, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | International Journal of Immunogenetics (2015) 42:294-296 |
B*38:68L | Deletion | Exon 4, 760-768delCTTGTGGAG, causes deletion of codons 229-231, which may affect expression | Scientific Reports (2019) 9:8067- |
B*38:173Q | Point | Exon 3, 5620564TGC>TAC, causes C164Y, this change affects the disuphide bond altering conformation of HLA-B and affecting expression | |
B*39:01:01:02L | Deletion | Promoter region, g-151-152delTC, causes a decrease in promoter activity and low expression of the allele is seen | |
B*39:38Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression |
Tissue Antigens (2006) 68:518-520 HLA (2017) 89:159-162 |
B*39:150Q | Point | Exon 1, 1-3ATG>AGG, causes M1V, this change affects the start codon, which may affect expression | |
B*39:194Q | Point | Exon 1, 1-3ATG>GTG, causes a non-synonymous change to the start codon, which may affect expression. | |
B*39:203Q | Point | Exon 3, 562-564TGC>TGG, in codon 164, causes C164R, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*40:02:01:32Q | Point | Intron 5, g2055T>C, a mutation in the splice site proceeding exon 4, which may affect expression | |
B*40:133Q | Point | Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | Tissue Antigens (2014) 83:184-189 |
B*40:421Q | Deletion | Exon 2, 211-219delGCGGGCGCC, causes the codons of codons 47-49, which may affect expression | |
B*40:509Q | Deletion | Exon 4, 764-767delTGG, causes 232delV which may affect expression | HLA (2024) 103:- |
B*40:600Q | Deletion | Exon 2, 280delCAACACACAGAC in codon 69 causes 69delAQA, which may affect expression | |
B*41:56Q | Point | Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*44:02:01:02S | Point | Intron 4, g1934A>G, causes incorrect splicing and the deletion of 117bp (exon 5), resulting in a soluble protein | Tissue Antigens (2004) 63:173-180 |
B*44:02:01:13Q | Point | Intron 3, g994T>C, causes a mutation in the splice site proceeding exon 3, which may affect expression. | |
B*44:138Q | Deletion | Exon 3, 353-355delCCC, causes deletion of codon 94, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | HLA (2019) 93:89-96 |
B*44:160Q | Point | Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*44:480Q | Deletion | Exon 3, 589-594delGAGAAC, causes the deletion of codons 173-174, which may affect expression | |
B*46:51Q | Point | Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | HLA (2017) 90:171-173 |
B*49:01:01:20Q | Point | Intron 2, g715A>G, affecting splice site preceding exon 3, which may affect expression. | |
B*51:01:01:97Q | Point | Intron 6, g2633G>C, a mutation in the splice site preceding exon 7, which may affect expression | |
B*51:173Q | Point | Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
B*51:329Q | Insertion | Exon 1, 11ins CGGCGCCCCGAACCGTCC, causes insertion of codons -20--15, which may affect expression | |
B*51:346Q | Insertion | Exon 3, 430insACG in codon 120, causes insertion of D, which may affect expression | |
B*51:393Q | Deletion | Exon 4, 783delGAG, causes 237delG, which may affect expression | |
B*51:394Q | Point | Exon 7, 1088-1090TGA>CGA, causes a mutation in the stop codon and results in the extension of the CDS by 24bp/8aa | HLA (2024) 103:- |
B*56:01:01:05S | Point | Intron 4, g1934A>G, causes incorrect splicing and the deletion of 117bp (exon 5), resulting in a soluble protein | HLA (2018) 92:250-251 |
B*57:98Q | Point | Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*57:185Q | Point | Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
B*58:155Q | Deletion | Exon 5, 936delTTGCTGGCCTGG causes 288delVAGL, which may affect expression | |
C*01:02:01:74Q | Point | Intron 4, g1859G>A, affecting splice site for exon 4, which may affect expression. |
HLA (2024) 103:- HLA (2024) 104:- |
C*01:02:01:79Q | Deletion | Intron 4, g1859delG in the splice site proceeding exon 4, which may affect expression | |
C*01:121Q | Point | Exon 3, 562-564TGC>AGC, causes C164S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*01:185Q | Deletion | Exon 5, 965-972delCTGTCCTAG, causes deletion of codons 298-300, which may affect expression | |
C*01:238Q | Point | Exon 3, 373-375TGC>TTG, causes C101L, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*02:02:02:34Q | Point | Intron 3, g996G>T, causes a mutation in the splice site after exon 3 | |
C*02:02:02:74Q | Point | Intron 2,g719A>G, a mutation in the splice site preceding exon 3, which may affect expression | |
C*02:25Q | Point | Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression |
Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 HLA (2017) 90:79-87 |
C*02:67Q | Point | Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | Tissue Antigens (2014) 83:184-189 |
C*02:205Q | Insertion | Exon 5, 1000insGT in codon 309, causes frameshift and delayed stop in the 3'UTR region. | |
C*02:211Q | Deletion | Exon 5, 965-973delCTGTCCTAG causes the deletion of codons 298-300, which may affect expression | |
C*02:215Q | Deletion | Exon 5, 965-973delCTGTCCTAG, causes 298-300delAVL, which may affect expression | |
C*02:240Q | Point | Exon 1, 1-3ATG>GTG, causes a non-synonymous change to the start codon, which may affect expression | HLA (2024) 104:- |
C*03:03:01:39Q | Point | Intron 3, g997T>A, causes a mutation in the splie site proceeding exon 3, which may affect expression | |
C*03:03:01:55Q | Point | Intron 2, g720G>C, causes a mutation in the splice site prior to exon 3 | |
C*03:04:01:35Q | Point | Intron 3, g996G>A, causes a mutation in the splice site after exon 3 | |
C*03:04:01:89Q | Point | Intron 2, g718A>G, affecting splice site preceding exon 3, which may affect expression. | |
C*03:04:01:90Q | Deletion | Intron 5, g2102delTAGG in the splice site proceeding exon 5, which may affect expression | |
C*03:22Q | Point | Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | Tissue Antigens (2006) 67:343-345 |
C*03:169Q | Point | Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | Tissue Antigens (2014) 83:184-189 |
C*03:244Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
C*03:442Q | Point | Exon 1, 1-3ATG>GTG, causes a non-synonymous change to the start codon, which may affect expression | |
C*03:448Q | Insertion | Exon 2, 223-237insTGGGTGGAGCAGGAG, causes 56-60insWVEQE, which may affect expression | |
C*03:502Q | Point | Exon 5, 907-909CAG>TAG, causes Q279X, which may affect expression | |
C*03:575Q | Point | Exon 3, 373-375TGC>TCC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
C*03:586Q | Deletion | Exon 3, 407-413delGGTATG, causes 113-114delGY, which may affect expression | |
C*03:666Q | Deletion | Exon5, 964-972delGCTGTCCTA, causing deletion of codon(s) 299-300, which may affect expression. | |
C*04:01:01:47Q | Point | Intron 4, g1860T>G, causes a mutation in the splice site after exon 4 | |
C*04:01:01:84Q | Point | Intron 5, g2538G>C, causes a mutation in the splice site prior to exon 6, which may affect expression | |
C*04:01:01:170Q | Point | Intron 2, g720G>A, a mutation in the splice site preceding exon 3, which may affect expression | |
C*04:01:01:176Q | Deletion | Intron 5, g2101delTAGG in the splice site proceeding exon 5, which may affect expression | |
C*04:01:01:188Q | Point | Intron 3, g1002T>A, affecting splice site for exon 3, which may affect expression. | |
C*04:01:01:189Q | Point | Intron 3, g996G>A in the splice site proceeding exon 3, which may affect expression | |
C*04:01:01:194Q | Point | Intron 3, g996G>T, affecting splice site for exon 3, which may affect expression. | |
C*04:09L | Deletion | Exon 7, 1095delA, in codon 341, causes frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 32 amino acids |
Human Immunology (2002) 63:295-300 Tissue Antigens (2002) 59:95-100 Tissue Antigens (2002) 59:95-100 Human Immunology (2013) 74:325-329 |
C*04:59Q | Point | Exon 3, 562-564TGC>TAG, causes C161Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression |
Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 |
C*04:338Q | Point | Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*04:382Q | Point | Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*04:428Q | Point | Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond althering conformation of HLA-C and affecting expression | HLA (2022) 99:370-371 |
C*04:456Q | Deletion | Exon 7, 1072delGATGAGTCTCT, causes a frameshift and premature stop in codon 337 | |
C*04:503Q | Deletion | Exon 4, 785delAGA, causes 238delG, which may affect expression | |
C*04:526Q | Deletion | Exon 2, 263delACACAGAAGTACAAGCGTCAG in codon 64, causes 63-69delTQKYKRQ, which may affect expression | |
C*05:01:01:53Q | Point | Intron 1, g203G>A, causes a mutation in the splice site prior to exon 2, which may affect expression | |
C*05:01:01:80Q | Point | Intron 2, g719A>C, causes a mutation in the splice site preceding exon 3, which may affect expression | |
C*05:01:01:81Q | Point | Intron 1, g203A>G, causes a mutation in the splice site, which may affect protein expression | HLA (2023) 102:93-95 |
C*05:01:01:89Q | Point | Intron 2, g718A>G, affecting splice site for exon 3, which may affect expression. | |
C*05:51Q | Deletion | Exon 3, 553-567delGAGGGCACGTGTGCGTG, causes deletion of codons 161-165, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | HLA (2017) 90:79-87 |
C*05:202Q | Deletion | Exon 2, 91-105delTATTTCTACACCGCC, causes deletion of codons 91-95, which may affect expression | |
C*05:282Q | Point | Exon 1, 1-3ATG>AGG, causes a change in the start codon, which may affect expression | HLA (2023) 102:370-371 |
C*06:02:01:99Q | Point | Intron 2, g719G>T, affecting splice site for exon 3, which may affect expression. | |
C*06:02:01:101Q | Point | Intron 7, 2890G>A in the splice site preceding exon 8, which may affect expression | |
C*06:74Q | Point | Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | Tissue Antigens (2014) 83:184-189 |
C*06:200Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*06:285Q | Point | Exon 1, 1-3ATG>ATA, causes a non-synonymous change to the start codon, which may affect expression | |
C*06:326Q | Point | Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering confirmation of HLA-C and affecting expression | |
C*06:336Q | Point | Exon 1, 1-3ATG>AAG, causes a non-synonymous change to the start codon, which may affect expression | |
C*06:396Q | Deletion | Exon 5, 954-962delGGCTGTCCT, causes deletion of codons 298-300, which may affect expression | |
C*07:01:01:14Q | Point | Intron 1, g203C>G, affecting splice site for exon 2, which may affect expression |
HLA (2018) 91:187-194 Human Immunology (2018) 79:763-772 |
C*07:01:01:100Q | Point | Intron 2, 718A>G, causes a mutation in the splice site preceding exon 3, which may affect expression | |
C*07:01:01:127Q | Point | Intron 2, g720G>A, in the splice site preceding exon 3, which may affect expression | |
C*07:02:01:74Q | Point | Intron 2, g2727G>A, causes a mutation in the splice site after to exon 7 | |
C*07:02:01:118Q | Point | Intron 1, g202A>G, in the splice site preceding exon 2, which may affect expression | |
C*07:02:01:124Q | Point | Intron 6, g2679G>A causes a mutation in the splice sites at the end of intron 6, which may affect expression | |
C*07:02:01:125Q | Point | Intron 3, 1002T>C causes a mutation in splice site proceeding exon 2, which may effect expression. | |
C*07:02:01:137Q | Point | Intron 2, g720G>A, causes a mutation in the splice site preceding exon 3, which may affect expression | |
C*07:04:01:15Q | Point | Intron 2, 718A>G, causes a mutation in the splice site preceding exon 3, which may effect expression | |
C*07:04:01:16Q | Point | Intron 1, 203G>C, causes a mutation in the splice site priot to exon 2 | |
C*07:06:01:05Q | Point | Intron 5, g2537G>A, causes a mutation in the splice site prior to exon 6 | |
C*07:121Q | Point | Exon 3, 562-564TGC>CGC, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression |
Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 |
C*07:150Q | Insertion | Exon 3, 499-500insCCCAGCGCAAGGTCAGATCAC, in codon 143, this change may affect the disulphide bond altering conformation of HLA-C and affecting expression | Tissue Antigens (2012) 79:50-57 |
C*07:226Q | Point | Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression |
Tissue Antigens (2014) 83:184-189 HLA (2017) 90:79-87 |
C*07:235Q | Point | Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*07:432Q | Point | Exon 3, 373-375TGC>CGC, causes C101R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*07:494Q | Point | Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*07:513Q | Point | Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | HLA (2017) 90:79-87 |
C*07:582Q | Point | Exon 3, 373-375TGC>GGC, in codon 101, causes C101G, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*07:632Q | Deletion | Exon 3, 598-600delAAG, causes deletion of codon 176, which may affect expression | HLA (2018) 92:233-234 |
C*07:663Q | Deletion | Exon 2, 217-225delGCGCCGTGG, causes a deletion of codons 49-51, which may affect expression | |
C*07:697Q | Point | Exon 3, 373-375TGC>TGG, causes C101W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*07:713Q | Point | Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*07:819Q | Insertion | Exon 3, 556-591insGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAG, causes insertion of codons 173-184, which may affect expression | |
C*07:974Q | Deletion | Exon 2, 121-124delCGC, causes 18delR, which may affect expression | |
C*07:985:01:02Q | Point | Intron 1, g203G>C in the splice site preceding exon 2, which may affect expression | HLA (2023) 102:243-245 |
C*07:1014Q | Deletion | Exon 4, 817-820delGTG, which causes 249delV, which may affect expression | |
C*07:1079Q | Deletion | Exon 3, 582-596delATACCTGGAGAACGG, causes 171-175delTLENG, which may affect expression | |
C*07:1114Q | Deletion | Premature stop in transmembrane region. Exon 5, 931delA in codon 287, causes a frameshift and premature stop at codon 297. | HLA (2024) 103:- |
C*07:1129Q | Point | Exon 3, 373-375TGC>CGC, in codon 101, causes C101R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*07:1160Q | Point | Exon 6, 1039-1041CAG>TAG, causes X323, a premature stop at codon 323 | HLA (2024) 104:- |
C*08:70Q | Point | Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | Tissue Antigens (2014) 83:184-189 |
C*08:141Q | Point | Exon 3, 375C>G, causes C101W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | HLA (2017) 90:79-87 |
C*08:225Q | Deletion | Exon 5, 978delT in codon 302, causes frameshift and premature stop at codon 303 | |
C*08:292Q | Deletion | Exon 3, 423delCCTACGACG in codon 117-119 causes delAYD, which may affect | |
C*12:02:02:24Q | Point | Intron 6, g2573G>T in the splice site proceeding exon 6, which may affect expression | |
C*12:02:02:26Q | Point | Intron 3, g996G>A, affecting splice site for exon 3, which may affect expression. | |
C*12:03:01:42Q | Point | Intron 3, g996G>A, causes a mutation in the splice site proceeding exon 3, which may affect expression | |
C*12:42Q | Point | Exon 3, 562-564TGC>TGG, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | Tissue Antigens (2014) 83:184-189 |
C*12:139Q | Point | Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | HLA (2017) 90:79-87 |
C*12:155Q | Point | Exon 3, 373-375TGC>TGG, in codon 101, causes C101W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | HLA (2017) 90:79-87 |
C*12:330Q | Deletion | Exon 5, 977delC, in codon 302, causes a frameshift and premature stop in codon 303 which may affect expression | |
C*12:342Q | Deletion | Exon 5, 965-972delGGCTGTCCT, causes deletion of codons 299-301, which may affect expression | |
C*12:351Q | Deletion | Exon 5, 977delC in codon 302, causes frameshift and premature stop at codon 303. Causes a premature stop in the TM region, | HLA (2024) 103:- |
C*12:393Q | Deletion | Exon 4 892delA in codon 273 causes a frameshift and premature stop at codon 297, which may effect expression. | |
C*14:105Q | Deletion | Exon 3, 548-550delACC, causes deletion of codon 159, which may affect expression | |
C*14:158Q | Deletion | Exon 4, 811-822delGTGGTGGTGCCT, causes the deletion of codons 247-250, which may affect expression | |
C*15:02:01:30Q | Point | Intron 1, g75T>C, causes a mutation in the splice site proceeding exon 1, which may affect expression | |
C*15:02:01:35Q | Point | Intron 2, 474G>C, causes mutation in splice site proceeding exon 2, which may affect expression | |
C*15:02:01:62Q | Point | Intron 1, g75T>G, causes a mutation in the splice site proceeding exon 1, which may affect expression | |
C*15:02:01:65Q | Point | Intron 5, g2537A>G, affecting splice site preceding exon 6, which may affect expression. | |
C*15:02:01:69Q | Point | Intron 7, g2727G>A in the splice site proceeding exon 7, which may affect expression | |
C*15:32Q | Point | Exon 3, 562-564TGC>GGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*15:84Q | Deletion | Exon 3, 550-555delCTGGAG, in codons 160-161, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | HLA (2017) 90:171-173 |
C*15:96Q | Point | Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression |
Tissue Antigens (2015) 86:302-303 HLA (2017) 90:79-87 |
C*15:105Q | Deletion | Exon 3, 399-401delCCT, a deletion of codon 110, which may affect expression | |
C*15:235Q | Point | Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
C*15:243Q | Point | Exon 3, 562-564TGC>TGG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*15:253Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression. | |
C*15:270Q | Deletion | Exon 1, 29delCTC in codon -15, causes -15delL, which may affect expression | |
C*15:272Q | Insertion | Exon 3, 595insAGATACCTGGAGAAC, causes 175insRYLEN, which may affect expression | |
C*16:01:01:42Q | Point | Intron 2, 718A>G in the splice site preceding exon 3, which may affect expression | |
C*16:16Q | Point | Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression |
Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 Tissue Antigens (2014) 83:184-189 |
C*16:174Q | Point | Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
C*17:01:01:16Q | Point | Intron 2, 718A>G, causes a mutation in the splice site preceding exon 3, which may effect expression | |
C*17:64Q | Insertion | Exon 2, 270insAAG, causes 67insK, which may affect expression | HLA (2022) 100:648-649 |
E*01:68Q | Point | Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-E and affecting expression | HLA (2021) 97:389-398 |
G*01:01:01:14Q | Point | Intron 1, g201A>G, causes a mutation in the splice site preceding exon 2, which may affect expression | HLA (2024) 104:- |
G*01:01:02:05Q | Point | Intron 3, g1573G>A, affecting splice site preceding exon 4, which may affect expression | |
G*01:04:01:04Q | Point | Intron 4, g1969A>G, causes a mutation in the splice site preceding exon 5, which may affect expression | |
G*01:36Q | Deletion | Exon 3, 393-407delTCGCCTCCTCCGCGG causes 108-112delRLLRG, which may affect expression | |
G*01:38Q | Point | Exon 1, 1-3ATG>ACG causes a mutation in the start codon, which may affect expression | |
G*01:50Q | Insertion | Exon 5, 956insG, causes a frameshift and extended CDS sequence with an additional 11 amino acids | |
DRB1*01:91Q | Deletion | Exon 3, 424-426delAAC, causes deletion of codon 113, which may affect expression | |
DRB1*11:248Q | Deletion | Exon 2, 285-293delCTTCCTGGA, causes the deletion of codons 66-68, which may affect expression | |
DRB1*11:272Q | Deletion | Exon 2, 280-282delAAG, causes the deletion of codon 65, which may affect expression | |
DRB1*11:297Q | Deletion | Exon 3, 502-504delAGG, causes 139delE, which may affect expression | HLA (2022) 99:619-621 |
DRB1*13:278Q | Deletion | Exon 2, 193-195delGAG, causes the deletion of codon 36, which may affect expression | |
DRB1*14:210Q | Insertion | Exon 2, 164-166insGGT, causes the insertion of codon 26, which may affect expression | |
DRB1*15:01:01:32Q | Point | Intron 3, g8123T>C, affecting splice site proceeding exon 3, which may affect expression. | |
DRB1*15:13Q | Deletion | Exon 2, 280-282delAAG, causes the deletion of codon 65, which may affect expression | |
DRB1*15:164Q | Deletion | Exon 2, 193-195delGAG, causes the deletion of codon 36, which may affect expression | |
DRB1*15:203Q | Insertion | Exon 2, 195insGAG causes insertion of codon 37, which may affect expression | |
DRB1*16:59Q | Deletion | Exon 2, 320-322delACT, causes the deletion of codon 78, which may affect expression | |
DRB3*02:61Q | Deletion | Exon 2, 193-195delGAG, causes deletion of codon 36 | HLA (2017) 90:186-187 |
DRB3*02:210Q | Deletion | Exon 4, 702delG in codon 205, causes a frameshift and premature stop at codon 239 | |
DRB3*03:57Q | Insertion | Exon 2, 286ins AGAAGGACC, causes 67insQKD, which may affect expression | |
DRB5*01:79Q | Deletion | Exon 2, 119-124delATAAGT, causes the deletion of codons 12-13, which may affect expression | |
DQA1*01:07Q | Point | Exon 2, 304-306CGC>TGC, causes R79C, which may affect expression. |
Tissue Antigens (1997) 50:334-339 Human Immunology (2005) 66:1248-1253 Tissue Antigens (2014) 83:49-51 Tissue Antigens (2015) 86:413-418 |
DQA1*01:40Q | Deletion | Exon 2, 322-324delGCT, causes deletion of codon 85, which may affect expression | |
DQA1*01:122Q | Point | Exon 4, 754-756CAA>TAA, causes X229, a premature stop at codon 229 | |
DQA1*01:133Q | Deletion | Exon 3, 411delACA in codon 114, causes 114delN, which may affect expression | HLA (2024) 103:- |
DQA1*02:01:15Q | Point | Intron 2, g4108G>C, causes a mutation in the splice site proceeding exon 2, which may affect expression | Frontiers in Genetics (2023) 14:- |
DQA1*03:03:01:16Q | Point | Intron 3, g5159G>A causes a mutation in the splice site preceding exon 4, which may affect expression | HLA (2021) 98:490-492 |
DQA1*03:50Q | Insertion | Exon 2, 198insGAG, causes the 44insE, which may affect expression | HLA (2023) 102:770-772 |
DQA1*04:21Q | Point | Exon 4, 721-723CGA>TGA, causes X218, a premature stop at codon 218 | |
DQA1*05:29Q | Point | Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression | |
DQA1*05:54:01Q | Point | Exon 4, 721CGA>TGA, causes Q218X, a premature stop in codon 218 | |
DQA1*05:54:02Q | Point | Exon 4, 721CGA>TGA, causes Q218X, a premature stop in codon 218 | |
DQA1*05:116Q | Point | Exon 1, 1-3ATG>ATA, causes a non-synonymous change to the start codon, which may affect expression. | |
DQB1*05:87Q | Deletion | Exon 3, 508-510delGAG, a deletion of codon 138, which may affect expression | |
DQB1*05:132Q | Deletion | Exon 3, 508-510delGAG, causes deletion of codon 138 | |
DQB1*05:313Q | Deletion | Exon 2, 198delAGA, cause 37delE, which may affect expression | |
DQB1*05:337Q | Deletion | Exon 3, 509delGAG, causes 137delE, which may affect expression | |
DQB1*06:02:01:18Q | Point | Intron 3, g4629G>A, causes a mutation in the splice site proceeding exon 3, which may affect expression | |
DQB1*06:03:01:23Q | Point | Intron 4, g5251G>C, affecting splice site proceeding exon 4, which may affect expression. | |
DQB1*06:416:01:01Q | Point | Exon 1, 1-3ATG>GTG, causes a non-synonymous mutation in the start codon, which may affect expression | |
DQB1*06:416:01:02Q | Point | Exon 1, 1-3ATG>GTG, causes a non-synonymous mutation in the start codon, which may affect expression | |
DQB1*06:439Q | Deletion | Exon 2, 375-378delGAG in codon 93, causes 95delR, which may affect expression | |
DQB1*02:01:01:16Q | Point | Intron 3, 5138A>G in the splice site preceding exon 4, which may affect expression | |
DQB1*02:01:01:21Q | Point | Intron 3, g4629G>A in the splice site proceeding exon 3, which may affect splicing | HLA (2024) 103:- |
DQB1*02:53Q | Deletion | Exon 2, 289-291delAAG, a deletion of codon 65, which may affect expression | HLA (2017) 90:79-87 |
DQB1*02:171Q | Deletion | Exon 2, 259-261delCTG, in codon 55, which may affect expression | |
DQB1*02:225Q | Deletion | Exon 4, 752delATC, causes 219delI, which may affect expression | |
DQB1*03:03:02:20Q | Point | Intron 4, 5251G>T in the splice site proceeding exon 4, which may affect expression. DQ9 was not detected by serology typing. | |
DQB1*03:19:01:02Q | Point | Intron 3, g4627G>A, causes a mutation in the splice site after exon 3 | HLA (2021) 97:171-172 |
DQB1*03:91Q | Insertion | Exon 2, 594-595insACTCCCCA, in codon 167, no internal stop codon | |
DQB1*03:99Q | Deletion | Exon 2, 189-191delCTA, in codon 31>32, no internal stop codon | HLA (2017) 90:171-173 |
DQB1*03:197Q | Deletion | Exon 2, 277-282delTGGAAC, a deletion of codons 61-62, which may affect expression | HLA (2017) 90:79-87 |
DQB1*03:480Q | Deletion | Exon 4, 749-756delTATCCGT, causes a frameshift and delayed stop in codon 231. | |
DQB1*03:564Q | Deletion | Exon 4,757delCAA, causes 221delQ, which may affect expression | |
DQB1*04:02:01:16Q | Point | Intron 3, 4630G>A in the splice site proceeding exon 3 which may affect expression | HLA (2022) 100:401-402 |
DPA1*01:03:01:18Q | Point | Intron 1, g101G>A, causes a mutation in the splice site, which may affect protein expression | |
DPA1*01:21Q | Deletion | Exon 2, 298-300delAAC, causes the deletion of codon 69, which may affect expression | |
DPA1*01:87Q | Point | Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression. | HLA (2022) 99:147-148 |
DPA1*01:163Q | Deletion | Exon 2, 208-211delAAG, causes 40delK, which may affect expression | |
DPA1*01:171Q | Deletion | Exon 3, 405delCCCTCATCTGCCACA, causes 104-108delTLICH, which may affect expression | |
DPA1*01:223Q | Point | Exon 1, 1-3ATG>ACT, causes a non-synonymous change to the start codon, which may affect expression | |
DPA1*02:02:02:17Q | Point | Intron 3, g4553G>A in the splice site proceeding exon 3, which may affect expression | |
DPA1*02:38Q | Deletion | Exon 4, 774-775delGG, causes frameshift and results in the extension of CDS by 78bp/26aa | |
DPA1*02:56Q | Deletion | Exon 2, 208-211delAAG, causes 38delK, which may affect expression | |
DPA1*02:64Q | Point | Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression | |
DPA1*02:102Q | Deletion | Exon 2, 298-300delAAC, causes 70delN, which may affect expression | HLA (2023) 102:546-548 |
DPA1*03:05:01:01Q | Point | Exon 1, 1-3ATG>ACT, causes a non-synonymous change to the start codon, which may affect expression | |
DPA1*03:05:01:02Q | Point | Exon 1, 1-3ATG>ACT, causes a non-synonymous change to the start codon, which may affect expression |
HLA (2024) 104:- HLA (2024) 104:- |
DPA1*03:05:02Q | Point | Exon 1, 1-3ATG>ATC in codon -31, causes a mutation in the start codon, which may affect expression | |
DPA1*03:20Q | Point | Exon 1, 1-3ATG>ACG in codon -31, causing a mutation to the start codon, which may affect expression. | |
DPB1*02:01:02:46Q | Point | Intron 4, g10054G>T, causes a mutation in the splice site after exon 4 | |
DPB1*697:01Q | Deletion | Exon 2, 274-276delAAG, in codon 63, causes deletion of codon 63 | |
DPB1*934:01Q | Insertion | Exon 2, 187-189delGAG, causes deletion of codon 34, which may affect expression | HLA (2023) 101:507-512 |
DPB1*935:01Q | Insertion | Exon 2, 130-143insACGGCCTACGCGTT, causes 17insLRQECYA, which may affect expression | |
DPB1*936:01Q | Deletion | Exon 2, 165-170delGAGATA, causes deletion of codons 26 and 27, which may affect expression | |
DPB1*1038:01Q | Insertion | Exon 3, 636insACC, causes insertion of codon 183, which may affect expression | |
DPB1*1092:01Q | Deletion | Exon 2, 340-348delGGCGGGCCC in codons 84-86, causes 84-86delGGP, which may affect expression | |
DPB1*1148:01Q | Deletion | Exon 3, 397-399delAAG, causes 104delK, which may affect expression. | |
DPB1*1317:01Q | Deletion | Exon 4, 745-747delAGG, causes 220delR, which may affect expression | |
DPB1*1444:01Q | Point | Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression | |
DPB1*1486:01Q | Insertion | Exon 2, 362insGCCCATGACCCTGCAGCGCCG, causes the addition of 7AA, which may affect expression | |
DPB1*1622:01Q | Point | Exon 5, 763-765CGA>TGA, causes X226, a premature stop at codon 226 | |
DPB1*1626:01Q | Point | Exon 1, 1-3ATG>ATT, which causes a mutation in the start codon, which may affect expression | |
MICA*002:01:13Q | Point | Intron 4, g8696 in the 5' end of intron 4, causes a mutation in the splice site, which may affect splicing | |
MICA*011:01:04Q | Point | Intron 2, g7267G>A, causes a mutation in the splice site proceeding exon 2, which may affect expression | |
MICA*105Q | Deletion | Exon 3, 607-609delGAG, causes 180delR, which may affect expression | |
MICA*171Q | Deletion | Intron 2, g7267G>A, causes a mutation in the splice site proceeding exon 2, which may affect expression |
Describing the mutations
The following recommendations are used for describing mutations in nucleotide sequences:
- The numbering of the nucleotides in the reference sequence should remain constant.
- For both gDNA and cDNA the 'A 'of the ATG initiator Methionine codon has been denoted nucleotide +1.
- The nucleotide immediately preceding the 'A' of the ATG initiator Methionine codon has been denoted nucleotide -1. Note: there is no nucleotide denoted 0.
- gDNA numbering is identified by the prefix 'g' e.g. g708G>A refers to position 708 of the gDNA and not 708 of the cDNA sequence.
- Nucleotide substitutions are designated using the nucleotide number followed by the substitution e.g. 997G>T denotes a substitution of G to T at position 997 of the DNA sequence.
- Deletions are designated by 'del' after the nucleotide number e.g. 997delT denotes the deletion of a T at position 997 of the DNA sequence. For deletions of a number of consecutive bases, the mutation would be described as 997-998delTG, which denotes a deletion of TG at positions 997 and 998 of the DNA sequence.
- Insertions are designated by 'ins' after the nucleotide numbers bordering the insertion e.g. 997-998insT represents an insertion of a T between bases 997 and 998 of the DNA. In the alignments produced, alleles that do not have a particular insertion will instead have a period (.) at that position. The numbering of the reference sequence will not be altered to include the inserted base. Insertions of multiple bases are designated using the same format e.g. 997-998insTG denotes an insertion of TG between positions 997 and 998 of the DNA.
Mutations in protein sequences follow a similar format:
- The numbering of the amino acids in the reference sequence should remain constant.
- For amino acid sequences, the first codon of the mature protein is labeled codon 1.
- All codons upstream to the first codon codon of the mature protein (5' direction) are numbered negatively and sequentially i.e. -1, -2, -3, etc.
- For describing amino acid changes, the reference amino acid is listed first, then the codon, and then the mutation e.g. Y97S represents a substitution of Tyrosine (Y) for a Serine (S) at codon 97.
- Stop codons are always designated by an 'X' e.g. T55X represents a Threonine (T) substituted for a stop (X) at codon 55.
- Deletions are designated using 'del' e.g. T69del is the deletion of a Threonine (T) at codon 69.
- Insertions are designated using 'ins' e.g. T101-102ins represents the insertion of a Threonine (T) between codons 101 and 102.