Null and Alternatively Expressed Alleles

Assigned as of September 2022

Here are listed all the HLA alleles that have been shown to be either not expressed (Null alleles that have the suffix 'N'), or the alleles that have been shown to be alternatively expressed have the suffix 'L', 'S', 'C', 'A' or 'Q'.

The suffix 'L' is used to indicate an allele that has been shown to have 'Low' cell surface expression when compared to normal levels. The 'S' suffix is used to denote an allele specifying a protein which is expressed as a soluble, 'Secreted' molecule, but is not present on the cell surface. A 'C' suffix is used to indicate an allele product which is present in the 'Cytoplasm', but not on the cell surface. An 'A' suffix is used to indicate an 'Aberrant' expression, specifically where there is some doubt as to whether a protein is expressed at all. A 'Q' suffix is used when the expression of an allele is 'Questionable' given that the mutation seen in the allele has previousÏly been seen in other aleles and shown to affect normal expression levels.

As of March 2018, there are no alleles which have been named with the 'C' or 'A' suffix.

All numbering and descriptions are based on an alignment to the exon sequence of the standard reference allele for that locus e.g. A*01:01:01:01 for null HLA-A alleles. A full explanation of how the mutations are described is provided after the table.

Null Alleles

Allele Mutation Description of Mutation References
A*01:01:01:02N Deletion Intron 2, g478-481delGTGA, causes translation of intron 2 sequence and an abnormal truncated peptide
A*01:04:01:01N Insertion Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 Tissue Antigens (1997) 50:347-350
Tissue Antigens (1999) 54:300-302
Tissue Antigens (1999) 54:300-302
Tissue Antigens (1999) 54:300-302
Transplantation (1999) 67:1336-1341
A*01:04:01:02N Insertion Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196
A*01:11N Point Exon 3, 968G>T, causes alternative splice site at the end of exon 3, resulting in a deletion of 24bp, which affects expression Human Immunology (2005) 66:912-920
Human Immunology (2005) 66:912-920
A*01:15N Deletion Exon 3, 559delC, in codon 163, causes frameshift and premature stop at codon 189 Tissue Antigens (2006) 67:61-63
Tissue Antigens (2009) 73:364-372
A*01:16N Insertion Exon 3, 532-533insG, in codon 154, causes frameshift and premature stop at codon 196 HLA (2018) 92:304-309
A*01:18N Point Exon 2, 214-216CGG>CCG, causes R48P, which may effect the binding of beta-2 microglobulin American Journal of Clinical Pathology (2004) 122:185-192
A*01:22N Deletion Exon 4, 751delG, in codon 272, causes frameshift and premature stop at codon 272
A*01:27N Point Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161 Human Immunology (2008) 68:913-914
A*01:31N Point Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 Tissue Antigens (2010) 76:149-150
A*01:52:01N Point Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 Tissue Antigens (2014) 83:184-189
A*01:52:02N Point Exon 3, 471G>A, causes W133X, a premature stop at codon 133 HLA (2017) 90:79-87
A*01:53N Point Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159
A*01:56N Point Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217
A*01:57N Point Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
A*01:87N Deletion Exon 4, 723delG, in codon 217, causes frameshift and premature stop at codon 272
A*01:123N Deletion Exon 3, 610delC, in codon 180, causes frameshift and premature stop at codon 189 Human Immunology (2015) 76:30-35
A*01:160N Point Exon 3, 535C>T, causes Q155X, a premature stop at codon 155
A*01:162N Point Exon 2, 286C>T, causes L72X, a premature stop at codon 72 HLA (2016) 87:31-35
A*01:178N Point Exon 3, 564C>A, causes C164X, a premature stop at codon 164
A*01:179N Point Exon 3, 580A>T, causes R170X, a premature stop at codon 170
A*01:186N Point Exon 2, 166C>T, in codon 32, causes Q32X, a premature stop at codon 32
A*01:240N Point Exon 2, 235G>T, causes E55X, a premature stop at codon 55
A*01:247N Insertion Exon 2, 270insA, in codon 66, causes frameshift and premature stop in codon 74
A*01:250N Deletion Exon 2, 261-262delGA, in codons 63-64, causes frameshift and premature stop in codon 73
A*01:258N Point Exon 3, 511-513TGG>TGA, causes X147, a premature stop in codon 147
A*01:269N Point Exon 2, 232-234CAG>TAG, causes X54, a premature stop in codon 54
A*01:285N Insertion Exon 2, 114insCGTCC, in codon 14, causes a frameshift and premature stop at codon 54.
A*01:287N Insertion Exon 4, 628insC, in codon 186, causes a frameshift and premature stop in codon 196
A*01:290N Deletion Exon 3, 540-541delGA, in codons 156-157, causes a frameshift and premature stop at codon 195
A*01:293N Insertion Exon 3, 562-569insAGGGCCGG, in codon 164, causes a frameshift and premature stop at codon 192
A*01:308N Point Exon 3, 367-369TAT>TAA, causes Y99X, a premature stop at codon 99 HLA (2019) 94:312-
A*01:320N Deletion Exon 3, 450-466delGAACGAGGACCTGCGCT in codons 126-132, causes frameshift and premature stop at codon 190
A*01:326N Deletion Exon 2, 280delC, in codon 70, causes frameshift and premature stop at codon 97
A*01:328N Point Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop at codon 224
A*01:336N Deletion Exon 2, 291-294delTGAC, in codons 73-74, causes frameshift and premature stop at codon 96
A*01:355N Deletion Exon 2, 191delCC in codon 40, causes frameshift and premature stop at codon 73
A*01:361N Point Exon 3, 415-417CAG>TAG, causes X115, a premature stop at codon 115
A*01:379N Deletion Exon 4, 626delC in codon 185, causes frameshift and premature stop at codon 189
A*01:384N Point Exon 2, 151-153TAC>TAA, causes X27, a premature stop at codon 27
A*01:394N Insertion Exon 3, 507insC, in codon 146, causes a frameshift and premature stop in codon 196
A*01:400N Point Exon 2, 223-225TGG>TAG, causes X51, a premature stop at codon 51
A*01:411N Point Exon 4, 799-781AAG>TAG, causes K243X, a premature stop in codon 243
A*01:417N Deletion Exon 3, 457-465delCCTGAACGAGGACCTGCGC in codon 125, causes a frameshift and premature stop at codon 183
A*01:418N Deletion Exon 3, 574delC in codon 168, causes a frameshift and premature stop at codon 189
A*01:420N Deletion Exon 4, 751delG in codon 227, causes a frameshift and premature stop at codon 272
A*01:421N Deletion Exon 4, 730delGATGGGGAGG in codon 220, causes a frameshift and premature stop at codon 269
A*02:15N Point Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 Immunogenetics (1996) 43:1-5
A*02:32N Point Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 Tissue Antigens (2000) 55:31-36
A*02:43N Insertion Exon 4, 779-780insC, in codon 236, causes frameshift and premature stop at codon 264
A*02:53N Point Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84 Tissue Antigens (2002) 59:328-330
A*02:82N Point Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164
A*02:83N Point Exon 4, 829-831GAG>TAG, causes Q253X, a premature stop at codon 253 Tissue Antigens (2005) 66:335-337
A*02:88N Point Exon 3, 418-420GAC>TAG, causes D116X, a premature stop at codon 116
A*02:94N Deletion Exon 2, 337delG, in codon 89, causes frameshift and premature stop at codon 126
A*02:113:01N Point Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 Tissue Antigens (2008) 72:176-177
Human Immunology (2018) 79:763-772
A*02:113:02N Point Exon 2, 250-252TGG>TGA, causes W60X, a premature stop at codon 60
A*02:125N Deletion Exon 2, 261delG, in codon 63, causes a frameshift and premature stop at codon 67 Tissue Antigens (2009) 74:424-428
A*02:222N Point Exon 3, 451-453AAA>TAA, causes K127X, a premature stop at codon 127
A*02:223N Point Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 Tissue Antigens (2014) 83:184-189
A*02:225N Point Exon 3, 439-441TAC>TAA, causes Y123X, a premature stop at codon 123 Tissue Antigens (2014) 83:184-189
A*02:226N Point Exon 3, 538-540TTG>TAG, causes L156X, a premature stop at codon 156
A*02:227N Point Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 Tissue Antigens (2013) 81:46-47
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
A*02:250N Deletion Exon 2, 286-287delCA, in codons 71-72, causes frameshift and premature stop at codon 195
A*02:284N Point Exon 3, 391-393TGG>TAG, causes W107X, a premature stop at codon 107
A*02:301N Deletion Exon 3, 426delC, in codon 118, causes frameshift and premature stop at codon 118
A*02:305N Deletion Exon 4, 814delG, in codon 248, causes frameshift and premature stop at codon 272 Tissue Antigens (2012) 79:130-131
A*02:314:01N Point Exon 3, 408-411 TAC>TAG, causes Y113X, a premature stop at codon 113
A*02:314:02N Point Exon 3, 408-411 TAC>TAA, causes Y113X, a premature stop at codon 113
A*02:321N Point Exon 2, 244-246GAG>TAG, causes Q58X, premature stop at codon 58
A*02:350N Point Exon 2, 337-339GAG>TAG causes E89X, a premature stop at codon 89 Tissue Antigens (2014) 83:184-189
A*02:356N Point Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 Tissue Antigens (2013) 82:136-137
A*02:366N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 Tissue Antigens (2014) 83:184-189
A*02:373N Point Exon 3, 514-516GAG>TAG, causes E148X, a premature stop at codon 148
A*02:395N Point Exon 2, 268-270AAA>TAA, causes K66X, a premature stop at codon 66 Tissue Antigens (2013) 81:451-452
A*02:439N Point Exon 3, 553-555GAG>TAG, causes E161X, a premature stop codon at 161
A*02:468:01N Point Exon 3, 571573TGG>TGA, causes W167X, a premature stop codon at 167 HLA (2017) 90:171-173
A*02:468:02N Point Exon 3, 571-573TGG>TAG, causes W167X, a premature stop codon at 167
A*02:476N Point Exon 3, 511-513TGG>TGA, causes W147X, a premature stop codon at 147 HLA (2017) 90:171-173
A*02:490N Point Exon 3, 373-375TGC>TGA, causes C101X, a premature stop codon at 101
A*02:501:01N Point Exon 3, 583-585TAC>TAG, causes Y171X, a premature stop codon at 171
A*02:501:02N Point Exon 3, 583-585TAC>TAG, causes X171, a premature stop at codon 171
A*02:506N Insertion Exon 4, 736-737insG, in codon 222, causes frameshift and premature stop at codon 264
A*02:514N Point Exon 2, 247-249TAT>TAG, causes Y57X, a premature stop at codon 59
A*02:516N Point Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101 HLA (2016) 87:31-35
A*02:525N Point Exon 2, 151-153TAC>TAA, causes Y27X , a premature stop at codon 27
A*02:540N Point Exon 3, 367-369TAT>TAG, causes Y99X, a premature stop at codon 99
A*02:608N Point Exon 4, 835-837CAG>TAG, causes Q255X, a premature stop at codon 255
A*02:622N Point Exon 3, 418-420TAC>TAA, causes D116X, a premature stop at codon 116 HLA (2016) 88:38-
A*02:643N Point Exon 3, 418-420TAC>TAG, causes Y116X, a premature stop at codon 116 HLA (2017) 90:362-364
A*02:675N Deletion Exon 4, 788delG, in codon 239, causes frameshift and premature stop at codon 164 HLA (2018) 91:187-194
A*02:691N Deletion Exon 4, 740delA, in codon 223, causes a frameshift and premature stop at codon 272
A*02:696:01N Point Exon 3, 549C>A, causes Y159X, a premature stop at codon 159 HLA (2020) 96:202-203
A*02:696:02N Point Exon 3, 547-549TAA>TAG, causes X159, a premature stop at codon 159. Is a silent variant of A*02:696N
A*02:710N Point Exon 5, 907C>T, causes Q279X mismatch, causes premature stop in codon 279
A*02:715N Deletion Exon 2, 91delT, in codon 7, causes frameshift and premature stop in codon 52
A*02:748N Point Exon 2, 325-327TAC>TAA, causes X85, a premature stop in codon 85
A*02:760N Point Exon 1, 19-21CGA>TGA, causes X-18, a premature stop in codon -18
A*02:773N Point Exon 3, 562-564TGC>TGA, causes X164, a premature stop in codon 164
A*02:775N Point Exon 3, 433-435AAG>TAG, causes X121, a premature stop in codon 121
A*02:788N Insertion Exon 3, 612insTGCA, in codon 180, causes a frameshift and premature stop at codon 197.
A*02:789N Point Exon 3, 424-426TAC>TAG, causes X118, a premature stop at codon 118
A*02:791N Deletion Exon 4, 817delG, in codon 249, causes a frameshift and premature stop at codon 272.
A*02:792N Deletion Exon 5, 941delG, in codon 290, causes a frameshift and premature stop at codon 297
A*02:793N Deletion Exon 4, 780delA, in codon 236, causes a frameshift and premature stop at codon 272
A*02:796N Deletion Exon 2, 127delG, in codon 19, causes a frameshift and premature stop in codon 52.
A*02:797N Deletion Exon 3, 474delC, in codon 134, causes a frameshift and premature stop at codon 156.
A*02:803N Deletion Exon 2, 133delC, in codon 21, causes a frameshift and premature stop at codon 52
A*02:806N Deletion Exon 2, 78-79delTC, in codons 2-3, causes a frameshift and premature stop at codon 195
A*02:807N Deletion Exon 3, 596-606delGGAAGGAGACG, in codons 175-178, causes a frameshift and premature stop at codon 192
A*02:831N Deletion Exon 3, 419delA, in codon 116, causes a frameshift and premature stop in codon 126
A*02:832N Deletion Exon 4, 675-679delTAGGT, in codons 201-203, causes a frameshift and premature stop in codon X262.
A*02:833N Insertion Exon 2, 166insG, in codon 32, causes a frameshift and premature stop at codon 152.
A*02:858N Deletion Exon 3, 574delC in codon 168, causes frameshift and premature stop at codon 18
A*02:871N Deletion Exon 4, 839-840delGA, in codon 256, causes frameshift and premature stop at codon 263
A*02:879N Insertion Exon 3, 523insC, in codon 151, causes frameshift and premature stop at codon 196
A*02:880N Insertion Exon 3, 610-613insCAGC, in codon 181, causes frameshift and premature stop at codon 197
A*02:887N Deletion Exon 3, 384delG, in codon 104, causes frameshift and premature stop at codon 126
A*02:895N Insertion Exon 3, 567insCGTG, in codon 166, causes frameshift and premature stop at codon 197
A*02:896N Deletion Exon 5, 913-920delACCATCCC, in codons 281-283, causes frameshift and premature stop at codon 312
A*02:915N Deletion Exon 4, 751delG, in codon 227, causes a frameshift and premature stop in codon 272
A*02:936N Point Exon 4, 724-726CAG>TAG, causes X218, a premature stop at codon 218
A*02:945N Deletion Exon 2, 270delA in codon 66 causes frameshift and premature stop at codon 67
A*02:946N Deletion Exon 3, 609delG, in codon 179, causes a frameshift and premature stop in codon 189
A*02:989N Point Exon 4, 721-723TGG>TGA, causes X217, a premature stop at codon 217
A*02:999N Point Exon 3,571-573TGG>TAG, causes W167X, a premature stop in codon 167
A*02:1006N Insertion Exon 4, 881insT, in codon 270, causes a frameshift and premature stop in codon 315
A*02:1016N Deletion Exon 3, 574delC in codon 168, causes a frameshift and premature stop at codon 189
A*02:1031N Deletion Exon 2, 257delGGGAGACA, in codon 62, causes a frameshift and premature stop at codon 71
A*02:1053N Point Exon 4, 856C>T causes X262, a premature stop at codon 262
A*02:1055N Point Exon 4, 802-804TGG>TGA, causes X244, a premature stop at codon 244
A*02:1059N Insertion Exon 2, 248insA in codon 59, causes frameshift and premature stop at codon 59
A*02:1061N Deletion Exon 4, 751delG, in codon 227, causes a frameshift and premature stop in codon 272
A*02:1062N Insertion Exon 3, 412(1-25)insGACTGGCGCTTCCTCCGCGGGTACC in codon 408 causes a frameshift and premature stop at codon 203
A*02:1063N Deletion Exon 3, 411delC in codon 113, causes a frameshift and premature stop at codon 126
A*02:1078N Insertion Exon 3, 642insC in codon 191, causes X196, a premature stop at codon 196
A*03:01:01:02N Point Intron 4, g1846G>A, causes incorrect splicing and the insertion of 65bp, resulting in a frameshift and premature stop codon
A*03:03N Deletion Exon 3, 373-378delTGCGAC, causes deletion of codons 101-102. Codon 101 is necessary for formation of the disulphide bridge Tissue Antigens (1996) 48:187-191
A*03:11N Point Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118
A*03:21N Insertion Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196
A*03:36N Deletion Exon 2, 264-290delACACGGAATATGAAGGCCCACTCACAG, deletion of codons 64-73, which affects cell surface expression
A*03:68N Point Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 Tissue Antigens (2014) 83:184-189
A*03:69N Point Exon 3, 538-540CGG>TAG, causes R156X, a premature stop at codon 156 Tissue Antigens (2014) 83:184-189
A*03:91N Point Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 Tissue Antigens (2014) 83:184-189
A*03:129N Deletion Exon 4, 651delC, in codon 193, causes frameshift and premature stop at codon 201
A*03:161N Point Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19
A*03:162N Insertion Exon 4, 664-665insCATG, in codon 198, causes frame shift and premature stop at codon 199 Tissue Antigens (2014) 83:53-54
A*03:168N Point Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27 Tissue Antigens (2014) 83:195-196
A*03:178N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 HLA (2016) 87:31-35
A*03:192N Point Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147
A*03:197:01N Point Exon 3, 409-411TAC>TAG, causes Y113X, a premature stop at codon 113
A*03:197:02N Point Exon 3, 409-411, TAG>TAA, causes X113, a premature stop at codon 113
A*03:262N Deletion Exon 3, 384-393delGGGGCCGGAC, causing frameshift and premature stop at codon 127 HLA (2017) 90:79-87
A*03:266N Deletion Exon 3, 543-544delAG, causes frameshift and premature stop at codon 195 HLA (2017) 90:79-87
A*03:269N Point Exon 3, 375C>A, causes C101X, a premature stop at codon 101 HLA (2017) 90:79-87
A*03:275N Point Exon 2, 225G>A, causes W51X, a premature stop at codon 51 HLA (2017) 90:109-110
A*03:279N Deletion Exon 4, 627delC, in codon 185, causes frameshift and premature stop at codon 189
A*03:283N Point Exon 2, 252G>A, causes W60X, a premature stop at codon 60 HLA (2018) 91:61-62
A*03:284N Deletion Exon 2, 204delG, in codon 44, causes frameshift and premature stop at codon 52 HLA (2017) 90:79-87
A*03:286N Point Exon 3, 508A>T, causes K146X, a premature stop at codon 146
A*03:297N Point Exon 3, 610-612CAG>TAG, causes X180, a premature stop in codon 180
A*03:323N Point Exon 3, 535-538CAG>TAG, causes X155, a premature stop in codon 155
A*03:329N Deletion Exon 2, 155-156delGT, in codon 28, causes a frameshift and premature stop in codon 73
A*03:330N Deletion Exon 2, 291-292delTG, in codons 73-74, causes a frameshift and premature stop in codon 151.
A*03:334N Insertion Exon 3, 508insC, in codon 146, causes a frameshift and premature stop at codon 152
A*03:335N Insertion Exon 2, 160insGTCG, in codon 30, causes frameshift and premature stop at codon 75
A*03:336N Deletion Exon 4, 691-703delGGCTTCTACCCTG, in codons 207-211, causes frameshift and premature stop at codon 211
A*03:337N Insertion Exon 3, 429-451insCGGCAAGGATTACATCGCCCTGA, in codon 127, causes a frameshift and premature stop at codon 134
A*03:342N Insertion Exon 3, 564-567insCGTG, in codon 166, causes a frameshift and premature stop at codon 197
A*03:357N Insertion Exon 3, 511insT in codon 147, causes frameshift and premature stop at codon 152
A*03:364N Deletion Exon 2, 251delA in codon 59, causes frameshift and premature stop at codon 67
A*03:374N Deletion Exon 1, 36-49delACTCTCGGGGGCCC, in codons -13--8, causes frameshift and premature stop at codon 69
A*03:381N Point Exon 3, 454-456, GAG>TAG, causes X128, a premature stop at codon 128
A*03:400N Deletion Exon 2, 254delA, in codon 61, causes a frameshift and premature stop in codon 67.
A*03:402N Insertion Exon 3, 611-614insCAGC in codon 181, causes frameshift and premature stop at codon 197
A*03:404N Point Exon 3, 514-516GAG>TAG, causes X148, a premature stop at codon 148
A*03:408N Insertion Exon 3, 512insAAGT in codon 147, causes frameshift and premature stop at codon 147
A*03:448N Point Exon 3, 571-572 TGG>TGA causes X167, a premature stop at codon 167
A*11:21N Insertion Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196
A*11:69N Point Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217 Tissue Antigens (2014) 83:292-293
A*11:78N Deletion Exon 2, 285-286delAC, causes frameshift and premature stop at codon 73 Tissue Antigens (2011) 77:257-258
A*11:99N Deletion Exon 2, 153delC, in codon 27, causes frameshift and premature stop at codon 27
A*11:109N Point Exon 3, 511-514TGG>TGA, causesW147X, a premature stop at codon 147
A*11:115N Point Exon 2, 151-153TAC>TAA , causes Y27X, a premature stop at codon 27
A*11:127N Point Exon 3, 583-585TAC>TAA , causes Y171X, a premature stop at codon 171 Tissue Antigens (2014) 84:510-511
A*11:137:01N Point Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118 Tissue Antigens (2014) 83:184-189
A*11:137:02N Point Exon 3, 426G>A, causes Y118X, a premature stop at codon 118 HLA (2017) 90:79-87
A*11:180N Deletion Exon 2, 307delG, in codon 79, causes frameshift and premature stop at codon 97
A*11:208:01N Point Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51
A*11:208:02N Point Exon 2, 223-225TAG>TGA, causes W51X, a premature stop at codon 51
A*11:210N Deletion Exon 4, 642delC, in codon 190, causes frame shift and premature stop at codon 201 Tissue Antigens (2015) 85:502-504
A*11:215N Point Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85
A*11:238N Point Exon 2, 199-201CAG>TAG, causes Q43X, a premature stop at codon 43
A*11:251N Insertion Exon 2, 204-205insAG, in codon 44, causes frameshift and premature stop at codon 53 HLA (2018) 92:167-168
A*11:287N Point Exon 2, 295-297CGA>TGA, causes X75, a premature stop in codon 75
A*11:310N Deletion Exon 3, 546delC, in codon 158, causes a frameshift and premature stop at codon 189
A*11:340N Insertion Exon 2, 164insC in codon 31, causes frameshift and premature stop at codon 74
A*11:347N Insertion Exon 1, 73insG, in codon 1, causes a frameshift and premature stop in codon 74
A*11:365N Deletion Exon 4, 786delT, in codon 238, causes a frameshift and premature stop in codon 272
A*11:382N Point Exon 4, 832-834GAG>TAG. causes E254X, a premature stop in codon 254 HLA (2021) 97:448-449
A*11:383N Point Exon 1, 67-69TGG>TAG, causes W-2X, a premature stop in codon -2 HLA (2022) 99:374-375
A*11:388N Point Exon 1, 61CAG>TAG, causes X-6, a premature stop at codon -6 HLA (2022) 99:374-375
A*11:397N Point Exon 3, 547TAC>TAA, in codon 159, causes Y159X, a premature stop in codon 159
A*11:400N Point Exon 4, 874-876AAG>TAG, causes X268, a premature stop at codon 268
A*11:403N Insertion Exon 1, 73insG, in codon 1, causes a frameshift and premature stop in codon 74
A*11:407N Insertion Exon 4 844insTACA, in codon 842, causes a frameshift and premature stop in codon 265
A*11:413N Deletion Exon 2, 127delG, in codon 19, causes a frameshift and premature stop in codon 52
A*11:417N Deletion Exon 1, 61delC, in codon -5, cause a frameshift and premature stop in codon 5 HLA (2022) 100:61-62
A*11:432N Point Exon 3, 547TAC>TAG, causes X159, a premature stop at codon 159
A*11:433N Insertion Exon 4, 628insC, in codon 186, causes a frameshift and premature stop in codon 196
A*23:07N Insertion Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196
A*23:08N Point Exon 3, 562-564TGC>TGA, causes c164X, a premature stop at codon 164
A*23:11N Insertion Exon 2, 150-151insAGCCCCGCTTCATCGCCGTGGGC, causes frameshift and premature stop at codon 60 HLA (2018) 92:304-309
A*23:19N Point Exon 3, 619G>A, in codon 183, mutation occurs at exon boundary, potentially affecting the splice site. Allele shown to be non-expressed. Human Immunology (2015) 76:286-291
A*23:38N Deletion Exon 2, 303delC in codon 77, causes frameshift and premature stop at codon 97 Tissue Antigens (2012) 79:71-72
A*23:84N Deletion Exon 2, 116-123delCCGGCCGC, in codons 15-17, causes frameshift and premature stop in codon 70
A*23:91N Point Exon 1, 67-69TGG>TGA, causes X-2, a premature stop in codon -2 HLA (2018) 92:408-409
A*23:103N Point Exon 4, 892-894, TGG>TAG, causes X274, a premature stop at codon 274
A*23:106N Deletion Exon 3, 545delC, in codon 158, causes a frameshift and premature stop in codon 189
A*23:108N Deletion Exon 3, 559-574delACGTGCGTGGACGGGC, in codons 163-168, causes frameshift and premature stop at codon 184
A*23:113N Insertion Exon 2, 150-151insAGCCCCGCTTCATCGCCGTGGGC, causes frameshift and premature stop at codon 60
A*24:09N Point Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop at codon 224 Journal of Immunology (1997) 158:5242-5250
A*24:11N Insertion Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 Journal of Immunology (1997) 158:5242-5250
A*24:36N Deletion Exon 2, 252-253delGG, in codon 60-61, causes frameshift and premature stop at codon 60 Tissue Antigens (2002) 60:184-185
HLA (2017) 90:79-87
A*24:40N Deletion Exon 4, 626-627delCC, in codon 185, causes frameshift and premature stop codon 195
A*24:45N Deletion Exon 2, 101-102delCA, in codon 10, causes frameshift and premature stop codon 73
A*24:48N Point Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154 HLA (2018) 92:304-309
A*24:60N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75
A*24:83N Point Exon 4, 697-699TAC>TAA, causes Y209X, a premature stop at codon 209
A*24:84N Point Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118
A*24:86N Insertion Exon 3, 614-615insGAAGGAGACGCTGCAGC, in codon 181, causes frameshift and premature stop codon 195 Tissue Antigens (2009) 73:63-65
A*24:90:01N Point Exon 3, 418-420GAC>TAG, causes Y116X, a premature stop at codon 116 Tissue Antigens (2010) 76:319-324
Tissue Antigens (2010) 76:319-324
HLA (2018) 92:304-309
HLA (2018) 92:304-309
A*24:90:02N Point Exon 3, 420G>A, causes X116X, a premature stop at codon 116
A*24:132N Point Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101 Tissue Antigens (2012) 80:464-465
A*24:155N Deletion Exon 4, 740delA, causes frameshift and premature stop codon at 272 Tissue Antigens (2011) 78:267-270
A*24:158N Deletion Exon 3, 453-454delCG, causes frameshift and premature stop at codon 195
A*24:163N Point Exon 4/5, 895-897GAG>TAG, causesW275X, a premature stop at codon 275 Tissue Antigens (2011) 78:267-270
A*24:183N Point Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 Tissue Antigens (2013) 82:136-137
A*24:185N Point Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54
A*24:222N Deletion Exon 3, 357delC, in codon 96, causes frame shift and premature stop at codon 97
A*24:232N Insertion Exon 2, 113-114insTCCCG, in codon 14, causes a frame shift and a premature stop codon at codon 54
A*24:240N Point Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84
A*24:252N Deletion Exon 2, 282delC, in codon 70, causes a premature stop at codon 97 HLA (2017) 90:79-87
A*24:278N Point Exon 3, 547-549TAC>TAG, causes Y159X, a premature stop at codon 159
A*24:303N Deletion Exon 3, 487delG, causes frameshift and premature stop at codon 189
A*24:312N Point Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27
A*24:323N Point Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141
A*24:357N Deletion Exon 3, 421-431delGCCTACGACGG, deletion of codons 117-119, causes frameshift and premature stop at codon 200 HLA (2017) 90:79-87
HLA (2017) 90:79-87
A*24:359N Deletion Exon 2, 249-250delTT deletion causing premature stop at codon 73 HLA (2017) 90:79-87
A*24:370N Point Exon 2, 256G>T, causes G62X, a premature stop at codon 62 HLA (2017) 90:79-87
A*24:388N Point Exon 3, 856C>T, causes Q262X, premature stop at codon 262 HLA (2017) 90:364-365
A*24:389N Deletion Exon 2, 253delG, in codon 61, causes frame shift and premature stop codon at codon 67
A*24:396N Deletion Exon 2, 335-338delGCGA deletion in codon 88-89, causes frameshift and premature stop in codon 96
A*24:408N Point Exon 3, 502-504AAG>TAG, causes X144, a premature stop in codon 144
A*24:425N Point Exon 2, 331-333CAG>TAG, causes X87, a premature stop in codon 87
A*24:426N Point Exon 2, 244-246GAG>TAG, causes X58, a premature stop in codon 58
A*24:427N Deletion Exon 4, 627delC, in codon 185, causes a frameshift and premature stop at codon 189.
A*24:428N Point Exon 2, 250-252TGG>TGA, causes X60, a premature stop at codon 60.
A*24:429N Insertion Exon 3, 354insT, in codon 95, causes a frameshift and premature stop at codon 196
A*24:430N Deletion Exon 4, 651delC, in codon 193, causes a frameshift and premature stop at codon 201.
A*24:433N Insertion Exon 3, 585insA, in codon 171, causes a frameshift and premature stop at codon 171
A*24:434N Insertion Exon 2, 128-131insAGCC, in codon 75, causes frameshift and premature stop at codon 75
A*24:435N Deletion Exon 2, 286-287delCA, in codon 73, causes frameshift and premature stop at codon 73
A*24:445N Insertion Exon 3, 379insCTCCAGATGATGTT, in codon 103, causes a frameshift and premature stop at codon 131
A*24:448N Point Exon 6, 1036-1038CAG>TAG, causes X322, a premature stop at codon 322
A*24:456N Deletion Exon 3, 560delC in codon 163, causes frameshift and premature stop at codon 18
A*24:467N Insertion Exon 4, 628insC, in codon 186, causes a frameshift and premature stop in codon 96
A*24:514N Deletion Exon 3, 571delG in codon 167, causes frameshift and premature stop in codon 189 HLA (2021) 97:527-529
A*24:517N Point Exon 2, 286-288CAG>TAG, causees Q72>X, a premature stop in codon 72 HLA (2021) 97:451-452
A*24:518N Insertion Exon 2, 208insG, in codon 46, causes a frameshift and premature stop in codon 74
A*24:529N Insertion Exon 2, 161insG in codon 30, causes frameshift and premature stop at codon 74
A*24:556N Deletion Exon 2, 219-295delTGAC, in codon 74, causes a frameshift and premature stop at codon 95
A*24:567N Deletion Exon 2, 129delG, in codon 26, causes a frameshift and premature stop in codon 52
A*24:568N Deletion Exon 4, 893-896delGGG, causes a frameshift and premature stop in codon 274.
A*24:576N Deletion Exon 4, 859delCATGA in codon 263, causes a frameshift and premature stop at codon 313.
A*25:12N Point Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159 Tissue Antigens (2014) 83:184-189
A*25:42N Point Exon 3, 553G>T, causes E161X, a premature stop at codon 161 HLA (2017) 90:79-87
A*25:49N Point Exon 3, 610-612CAG>TAG, causes X180, a premature stop in codon 180
A*25:69N Deletion Exon 2, 80delA, in codon 3, causes frameshift and premature stop at codon 5
A*26:01:01:03N Point Intron 4, g1846G>A, causes incorrect splicing and the insertion of 62bp, resulting in a frameshift and premature stop codon HLA (2016) 88:260-261
A*26:11N Insertion Exon 3, 516-517insAC, in codon 149, causes frameshift and premature stop at codon 190
A*26:25N Insertion Exon 2, 280-281insC, in codon 70, causes frameshift and premature stop at codon 74
A*26:60N Point Exon 3, 424-426>TAC>TAG, causes Y118X, a premature stop at codon 118 Tissue Antigens (2014) 83:184-189
A*26:71N Point Exon 2, 223-225>TGG>TAG, causes W51X, a premature stop at codon 51 Tissue Antigens (2014) 83:184-189
A*26:107N Point Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 Tissue Antigens (2015) 85:502-504
A*26:127N Point Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154
A*26:145N Point Exon 2, 232C>T, causes E54X, a premature stop at codon 54
A*26:161N Insertion Exon 3, 454insC, in codon 128, causes frameshift and premature stop in codon 152
A*26:180N Insertion Exon 3, 666-669insTCTG, in codon 200, causes frameshift and premature stop at codon 265
A*26:191N Deletion Exon 4, 751delG, in codon 227, causes frameshift and premature stop at codon 272
A*26:202N Point Exon 1, 61-63, CAG>TAG, causes X-4, a premature stop a codon -4
A*26:206:01N Point Exon 3, 393-395TGG>TAG, causes W171X, a premature stop in codon 171 HLA (2020) 96:717-718
A*26:206:02N Point Exon 3, 512-514TGG>TGA, causes X147, a premature stop at codon 147
A*26:210N Point Exon 3, 535-537CAG>TAG, causes X155, a premature stop at codon 155
A*29:01:01:02N Point Intron 4, g1846G>T, causes incorrect splicing and the insertion of 62bp, resulting in a frameshift and premature stop codon Tissue Antigens (2002) 59:139-141
A*29:08N Point Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51
A*29:78N Point Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72
A*29:112N Deletion Exon 2, 286-287delCA in codon 72, causes a frameshift and premature stop in codon 73
A*30:27N Point Exon 3, 535-537GAG>TAG, causes Q155X, a premature stop at codon 155
A*30:59N Point Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 Tissue Antigens (2013) 82:430-432
A*30:70N Deletion Exon 2, 208-210delG, in codon 46, causes frame shift and premature stop at codon 52 HLA (2018) 92:304-309
HLA (2018) 92:304-309
A*30:73N Insertion Exon 3, 516-517insCGGACATGGCGGCTCAGATCACCCAGCGCAAGTGGGAG, in codon 148, causes a frame shift and a premature stop codon at codon 169
A*30:76N Point Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19
A*30:78N Deletion Exon2, 188delA, in codon 39, causes a frame shift and premature stop codon at codon 52
A*30:121N Point Exon 3, 514G>T, causes E148X a premature stop at codon 148
A*30:123N Point Exon 3, 412G>T, causes E114X, a premature stop at codon 114
A*30:130N Insertion Exon 4, 628-629insCC, in codon 186, causes frameshift and premature stop in codon 190 HLA (2018) 92:324-326
A*30:132N Insertion Exon 4, 628insC in codon 186, causes frameshift and premature stop in codon 196 HLA (2018) 92:233-234
A*30:145N Insertion Exon 3, 490insACATGGCG, in codon 140, causes a frameshift and premature stop at codon 159
A*30:158N Deletion Exon 3, 509delA in codon 146, causes frameshift and premature stop at codon 156
A*30:178N Point Exon 3, 511-513TGG>TGA, causes X147, a premature stop at codon 147
A*30:197N Point Exon 3, 598-600AAG>TAG, causes X176, a premature stop in codon 176
A*30:204N Insertion Exon 2, 305insT in codon 78, causes X114, a premature stop at codon 114
A*31:01:02:03N Deletion Intron 1, g176-185delGCGGATCTCA, affecting splice site for intron 1
A*31:14N Insertion Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 Tissue Antigens (2006) 68:526-527
A*31:60N Point Exon 3, 373-375TGC>TGA , causes G101X, a premature stop at codon 101
A*31:126N Point Exon 3, 369T>G, causes Y99X, a premature stop at codon 99 HLA (2018) 91:534-535
A*31:131N Point Exon 2, 295C>T, causes R75X, premature stop at codon 75
A*31:141N Insertion Exon 2, 80insC, in codon 3, causes a frameshift and premature stop in codon 58
A*31:149N Deletion Exon 3, 372-382delCTGCGACGTGG, in codons 100-104, causes a frameshift and premature stop at codon 192
A*31:158N Insertion Exon 2, 190insG, in codon 40, causes frameshift and premature stop at codon 58
A*31:184N Point Exon 1, 67-69TGG>TAG, causes W-2X, a premature stop in codon -2
A*31:188N Deletion Exon 3, 481delG in codon 136, causes frameshift and premature stop at codon 156 HLA (2022) 100:70-71
A*31:201N Point Exon 3, 547-549TAC>TAA, causes X159, a premature stop in codon 159
A*31:202N Point Exon 2, 247-249TAT>TAA in codon 59, causes a frameshift and premature stop in codon 59
A*32:19N Point Exon 3, 571-573GGG>TGA, causes G167X, a premature stop at codon 167 Tissue Antigens (2009) 74:553-554
A*32:27N Point Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
A*32:45N Point Exon 3, 508-510AAG>TAG, causes K146X, a premature stop at codon 146 Tissue Antigens (2014) 83:184-189
A*32:48N Point Exon 3, 409-411 TAC>TAG, causes Y113X, a premature stop at codon 113 Tissue Antigens (2014) 83:184-189
A*32:56N Deletion Exon 2, 233delA, in codon 54, causes frameshift and premature stop at codon 67
A*32:92N Insertion Exon 3, 617-630insGAGACGCTGCAGCG in codon 181, causes frameshift and premature stop at codon 194 HLA (2017) 90:79-87
A*32:112N Point Exon 2, 325-327TAC>TAA, causes X85, a premature stop in codon 85
A*32:117N Point Exon 5, 994-996TGG>TAG, causes X308, a premature stop in codon 308
A*32:126N Deletion Exon 2, 286-287delCA, in codon 72, causes a frameshift and premature stop at codon 73
A*32:130N Insertion Exon 2, 280insC, in codon 70, causes frameshift and premature stop at codon 74
A*32:132N Point Exon 3, 373-375TGC>TGA, causes C101X, a premature stop in codon 101
A*32:133N Insertion Exon 3, 579insAG, in codon 169, causes frameshift and premature stop at codon 190
A*32:135N Insertion Exon 2, 129insA, in codon 19, causes a frameshift and premature stop in codon 37
A*32:160N Point Exon 3, 424-426TAC>TAG), causes Y118X, a premature stop in codon 118
A*32:167N Deletion Exon 2, 200-213delAGAGGATGGAGCC in codon 43, causing a frameshift and premature stop at codon 48
A*32:168N Deletion Exon 4, 895delG, in codon 275, causes a frameshift and premature stop in codon 291
A*33:73N Insertion Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196
A*33:74N Point Exon 4, 802-804TGG>TAG, causes W244X, a premature stop at codon 244 HLA (2017) 90:365-366
A*33:80N Point Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118 HLA (2017) 90:171-173
A*33:96N Point Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133
A*33:123N Deletion Exon 2, 320delG, in codon 83 causes frameshift and premature stop codon 97 HLA (2017) 90:79-87
A*33:129N Insertion Exon 4, 627-628insC, in codon 186 causes frameshift and premature stop at codon 196 HLA (2018) 92:243-244
A*33:140N Point Exon 3, 454GAG>TAG, causes E128X, a premature stop in codon 128
A*33:143N Deletion Exon 3, 389delA, in codon 106, causes frameshift and premature stop in codon 126
A*33:154N Point Exon 2, 325-327TAC>TAA, causes X85, a premature stop in codon 85
A*33:156N Point Exon 4, 856-858CAG>TAG, causes X262, a premature stop in codon 262
A*33:157N Point Exon 4, 697-699TAC>TAG, causes X209, a premature stop at codon 209
A*33:174N Deletion Exon 3, 656-657delCT, in codon 195, causes a frameshift and premature stop at codon 195
A*33:176N Deletion Exon 3, 472-485delACCGCGGCGGACAT, in codons 134-138, causes a frameshift and premature stop at codon 191 HLA (2019) 94:316-317
A*33:194N Point Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop in codon 141.
A*33:198N Point Exon 3, 511-513, TGG>TAG, causes X147, a premature stop at codon 147
A*33:213N Point Exon 3, 367-369TAT>TAG, in codon 99, causes Y99X, a premature stop in codon 99
A*33:229N Point Exon 3, 439-401TAC>TAG, causes X123, a premature stop at codon 123
A*33:230N Insertion Exon 3, 601insG in codon 177, causes a frameshift and premature stop at codon 196
A*34:10N Point Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115
A*34:26N Deletion Exon 4, 779delC, in codon 235, causes a frameshift and premature stop in codon 272
A*34:29N Point Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop in codon 54
A*34:30N Point Exon 3, 409-411TAC>TAA, causes X113, a premature stop at codon 113
A*43:02N Deletion Exon 4, 637-638delAT in codon 189, causes frameshift and premature stop at codon 195
A*66:27N Point Exon 2, 327-329TAC>TAA, causes Y85X, a premature stop at codon 85
A*66:28N Deletion Exon 4, 627delC, in codon 185, causes a frameshift and premature stop at codon 189 HLA (2018) 92:169-170
A*66:39N Point Exon 3, 454-456GAG>TAG, causes E128X, a premature sop in codon 128
A*68:11N Deletion Exon 1, 46delG, in codon 9, causes frameshift and premature stop at codon -6 Tissue Antigens (1999) 53:573-575
A*68:18N Insertion Exon 2, 213-214insCGAGCCAGAGGATGGAGCCG, between codons 47-48, causes frameshift and premature stop at codon 59 Tissue Antigens (2002) 60:88-90
HLA (2017) 90:79-87
A*68:49N Point Exon 3, 511-513TGG>TAG, causes W147X, a premature stop at codon 147 Tissue Antigens (2014) 83:184-189
A*68:59N Point Exon 3, 511-513TGG>TAG, causes W147X, a premature stop at codon 147 Tissue Antigens (2014) 83:184-189
A*68:94N Point Exon 2, 253-255TGG>TAG , causes W51X, a premature stop at codon 51
A*68:120N Point Exon 3, 385-387TCG>TAG, causes S105X, a premature stop at codon 105
A*68:142N Deletion Exon 2, 240delG, in codon 56, causes frameshift and premature stop at codon 67
A*68:171:01N Point Exon 3, 540G>A, causes W156X, a premature stop at codon 156
A*68:171:02N Point Exon 3, 540G>A, causes W156X, a premature stop at codon 156
A*68:181N Point Exon 3, 553-555GAG>TAG, causes X161, a premature stop in codon 161
A*68:182N Point Exon 3, 358-360CAG>TAG, causes X96, a premature stop in codon 96
A*68:199N Insertion Exon 3, 574-587insTGATCCTCATGGGG, in codon 168, causes a frameshift and premature stop at codon 168.
A*68:203N Deletion Exon 3, 359delA, in codon 96, causes a frameshift and premature stop at codon 97
A*68:205N Insertion Exon 3, 384insG, in coodn 105, causes a frameshift and premature stop at codon 196
A*68:210N Insertion Exon 2, 249-262insGTATTGGGACCGGA, in codon 63, causes a frameshift and premature stop at codon 72
A*68:213N Point Exon 2, 247-249TAT>TAG in codon 59, causes Y59X, a premature stop at codon 59 HLA (2021) 97:60-62
A*68:216N Deletion Exon 1, 61delC in codon -4, causes frameshift and premature stop at codon
A*68:236N Deletion Exon 2, 134delG in codon 21, causes frameshift and premature stop at codon 52
A*68:245N Point Exon 3, 409-411, TAC>TAA, causes X113, a premature stop at codon 113
A*68:251N Deletion Exon 2, 132-133delCC, causes a frameshift and premature stop in codon 71
A*68:266N Deletion Exon 2, 213-233delGCGGGCGCCGTGGATAGAGC in codon 47, causes frameshift and premature stop at codon 67.
A*68:267N Insertion Exon 2, 228insA in codon 53, causes frameshift and premature stop at codon 74
A*68:269N Point Exxon 2, 295-297CGA>TGA, causes X75, a premature stop at codon 75
A*68:281N Point Exon 2, 250-252TGG>TGA, causes X60, a premature stop in codon 60
A*68:292N Deletion Exon 2, 117delC, in codon 15, causes a frameshift and premature stop in codon 52
A*74:12N Deletion Exon 3, 357-362delCCAGAT, causes deletion of codons 95-97. Protein is not detected at cell surface by pan-class I antibody.
A*74:14N Point Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51
A*74:32N Point Exon 3, 424-426TAC>TAG, causes X118, a premature stop in codon 118
A*80:08N Point Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop in codon 224
A*80:09N Point Exon 3, 454-456GAG>TAG, causes E128X, a premature stop in codon 128
B*07:44N Point Exon 4, 852T>G, causes alternative splice site at the end of exon 4, resulting in a deletion of 43bp, which affects expression HLA (2017) 89:230-234
HLA (2017) 89:230-234
B*07:49N Point Exon 4, 892-894TGG>TAG, causes W274X, a premature stop at codon 274 Tissue Antigens (2007) 70:341-343
B*07:67N Deletion Exon 2, 117delC, in codon 15, causes frameshift and premature stop at codon 34
B*07:111N Point Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
B*07:135N Point Exon 3, 553-555GAG>TAG, causes G161X, premature stop at codon 161
B*07:161N Insertion Exon 5, 961insT, in codon 297, causes a frame shift and premature stop at codon 309 Human Immunology (2018) 79:763-772
B*07:167N Point Exon 3, 502-504 CAG-TAG, causes Q144X, a premature stop at codon 144 Tissue Antigens (2014) 83:184-189
B*07:181N Point Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65 Tissue Antigens (2014) 83:184-189
B*07:182N Point Exon 3, 418-420TAC>TAA, causes Y116X, a premature stop at codon 116
B*07:201N Point Exon 3, 502-504CAG>TAG, causes Q502X, a premature stop at codon 144
B*07:231N Point Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84 HLA (2016) 87:31-35
B*07:251N Deletion Exon 3, 535delC, in codon 155, causes frameshift and premature stop at codon 189
B*07:272N Point Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at 101
B*07:285N Deletion Exon 3, 491delC, in codon 140, causes frameshift and premature stop codon 189 HLA (2017) 90:79-87
B*07:315N Point Exon 2, 295-297CGA>TGA, causes X75, a premature stop in codon 75
B*07:316N Deletion Exon 2, 201-204delGAGA in codons 44 and 45, causes frameshift and premature stop in codon 51
B*07:318N Point Exon 2, 166-168CAG>TAG, causes X32, a premature stop in codon 32
B*07:325N Point Exon 2, 280-282CAG>TAG, causes X70, a premature stop in codon 70
B*07:330N Point Exon 4, 748-750CAG>TAG, causes X226, a premature stop in codon 226
B*07:343N Deletion Exon 3, 610-619delGAGCGCGCTG, in codons 180-183, causes a frameshift and premature stop at codon 186
B*07:351N Deletion Exon 2, 264delA, in codon 64, causes a frameshift and premature stop at codon 126
B*07:373N Deletion Exon 4, 701delC, in codon 210, causes frameshift and premature stop at codon 215
B*07:374N Deletion Exon 5, 896-909delAGCCGTCTTCCCAG in codons 275-279, causes frameshift and premature stop at codon 304
B*07:415N Point Exon 2, 100-102TAC>TAG, causes X9, a premature stop at codon 9
B*07:425N Point Exon 1, 19-21, CGA>TGA, causes X-19, a premature stop at codon -19
B*07:435N Insertion Exon 3, 584insA, in codon 171, causes a frameshift and premature stop in codon 171
B*07:446N Point Exon 2, 337-339GAG>TAG, causes X89, a premature stop in codon 89
B*07:460N Deletion Exon 3, 419delA, causes a frameshift and premature stop in codon 126
B*07:468N Deletion Exon 3, 607delC, in codon 179, causes a frameshift and premature stop in codon 189
B*07:469N Insertion Exon 3, 451(1-13)insTACATCGCCCTGA in codon 126, causes a frameshift and premature stop at codon 156
B*08:08N Deletion Exon 3, 473delC, in codon 134, causes frameshift and premature stop at codon 189 Tissue Antigens (2000) 55:61-64
B*08:19N Point Exon 4, 724-726CAG>TAG, causes Q218X, a premature stop at codon 218
B*08:30N Point Exon 3,424-426TAC>TAA, causes Y118X, a premature stop at codon 118
B*08:67:01N Point Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51
B*08:67:02N Point Exon 2, 223-225TGA>TAG, causes W51X, a premature stop in codon 51 HLA (2021) 98:55-56
B*08:72N Point Exon 2, 295-297CGA>TGA, causes R75X, premature stop at codon 75 Tissue Antigens (2014) 83:184-189
B*08:82N Point Exon 3, 589-591GAG>TAG, causes E173X, a premature stop at codon 173 Tissue Antigens (2014) 83:184-189
B*08:86N Point Exon 3, 571-573TGG>TGA, causes W167X, a premature stop at codon 167 Tissue Antigens (2014) 83:184-189
B*08:148N Deletion Exon 3, 263-266delCACA, in codons 64-65, causes frameshift and premature stop at codon 125 HLA (2017) 90:79-87
B*08:214N Insertion Exon 3, 351insA, in codon 93, causes a frameshift and premature stop at codon 114.
B*08:215N Deletion Exon 2, 265-266delCA, in codon 65, causes a frameshift and premature stop at codon 73.
B*08:220N Point Exon 2, 250-252TGG>TGA, causes X60, a premature stop at codon 60.
B*08:236N Point Exon 4, 832-834GAG>TAG, causes E254X, a premature stop at codon 254
B*08:252N Point Exon 3, 637-639, CAG>TAG, causes X181, a premature stop at codon 181
B*08:279N Point Exon 3, 583-585TAC>TAG, causes Y171X, a premature stop in codon 171
B*08:287N Point Exon 3, 415-418CAG>TAG, causes Q115X, a premature stop at codon 115
B*08:293N Point Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop in codon 141.
B*13:07N Deletion Exon 2, 254-268delACCGGAACACACAGA, codons 61-66, causes no frameshift but exon 2 is 5 amino acids shorter
B*13:49N Point Exon 3, 439-441TAC>TAA, causes Y123X, premature stop at codon 123 Tissue Antigens (2014) 83:184-189
B*13:56:01N Point Exon 3, 424-426TAC>TAA, casues Y118X, premature stop at codon 118 Tissue Antigens (2014) 83:184-189
B*13:56:02N Point Exon 3, 424-426TAA>TAG, causes X118X, a premature stop codon at 118
B*13:63N Insertion Exon 3, 584-585insA, in codon 171, causes frame shift and premature stop at codon 171 Tissue Antigens (2013) 81:459-460
B*13:76N Point Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop at codon 96
B*13:103N Deletion Exon 3, 454G>T, causes E128X, a premature stop at codon 128 HLA (2019) 94:318-319
B*13:116N Point Exon 5, 907-909CAG>TAG, causes X279, a premature stop at codon 279
B*13:137N Deletion Exon 2, 168delG, in codon 32, causes frameshift and premature stop at codon 34
B*13:139N Point Exon 4, 682-684, TGG>TGA, causes X204, a premature stop at codon 204
B*13:161N Deletion Exon 2, 149delG in codon 26, causes frameshift and premature stop at codon 34.
B*14:07N Point Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164
B*14:41N Deletion Exon 3, 523delC, in codon 151, causing frameshift and premature stop at codon 156 Tissue Antigens (2015) 86:208-209
B*14:69N Point Exon 4, 892-894TGG>TGA, causes W274X, a premature stop at codon 274 HLA (2020) 96:13-23
B*14:72N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop in codon 75
B*14:76N Point Exon 4, 682-684TGG>TAG, causes W204X, a premature stop at codon 20
B*14:79N Deletion Exon 3, 352-353delAC in codon 94, causes frameshift and premature stop at codon 113
B*14:85N Point Exon 1, 19-21, CGA>TGA, causes X-18, a premature stop at codon -18
B*14:100N Deletion Exon 4, 814-815delGG, in codons 247-248, causes a frameshift and premature stop in codon 263
B*14:101N Deletion Exon 1, 19delC in codon -18, causes frameshift and premature stop at codon -5
B*14:113N Point Exon 5, 907-909CAG>TAG, causes X279, a premature stop at codon 279
B*15:01:01:02N Deletion Intron 1, g175-184delCGGGTCTCAG, causes incorrect splicing and the insertion of 74bp, resulting in a frameshift and premature stop codon Tissue Antigens (1999) 53:244-252
B*15:26N Point Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 Tissue Antigens (1997) 50:351-354
B*15:79N Insertion Exon 2, 328-329insCA, in codon 86, causes frameshift and premature stop at codon 127
B*15:94N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75
B*15:111N Deletion Exon 3, 527-536delAGGCGGAGCA, codons 152-155, causes frameshift and premature stop at codon 186
B*15:149N Deletion Exon 2, 264-265delAC, in codons 64-65, causes frameshift and premature stop at codon 113 Tissue Antigens (2009) 74:447-449
B*15:181N Point Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144 Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
B*15:182N Point Exon 2, 91-93TAT>TAG, causes Y7X, a premature stop at codon 7 Tissue Antigens (2014) 83:184-189
B*15:190N Point Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147 Tissue Antigens (2014) 83:184-189
B*15:209N Point Exon 3, 469-471TGG>TGA, causes W133X, a premature stop at codon 133 Tissue Antigens (2011) 78:267-270
B*15:226N Point Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87 HLA (2016) 88:201-203
B*15:246N Deletion Exon 2, 264-265delAC, in codon 64-65, causes frameshift and premature stop at codon 113
B*15:258N Point Exon 3, 583-585TAC>TAA, causes Y171X, a premature stop at codon 171
B*15:262:01N Point Exon 3, 367-369insGACG, in codon 99, causes frameshift and premature stop at codon 115
B*15:262:02N Insertion Exon 3, 367-369insGATG, in codon 99, causes a frameshift and premature stop at codon 115
B*15:272N Point Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop codon at 118 HLA (2017) 90:79-87
B*15:294N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 HLA (2016) 87:31-35
B*15:302N Deletion Exon 4, 723delG, in codon 217, causes frameshift and premature stop at codon 314
B*15:304N Deletion Exon 2, 137-147delTCATCGCAGTG, in codons 22-25, causes frameshift and a premature stop at codon 110 HLA (2017) 90:171-173
B*15:375N Deletion Exon 3, 472-478delACCGCGG, codons 134-136, causes frameshift and premature stop at codon 187 HLA (2016) 87:104-106
B*15:380N Deletion Exon 4, 852delT, in codon 261, causes frameshift and premature stop at codon 272
B*15:400N Deletion Exon 2, 400-403delCTCC, in codon110, causes frameshift and premature stop at codon 125 HLA (2018) 92:100-101
B*15:454N Point Exon 3, 570-572TGG>TAG. causes X167, a premature stopn in codon 167
B*15:463N Deletion Exon 3, 437delA, in codon 122, causing a frameshift and a premature stop in codon 126
B*15:483N Point Exon 4, 682-684TGG>TAG. causes X204, a premature stop in codon 204
B*15:487N Deletion Exon 4, 836delA, in codon 264, causes a frameshift and premature stop in codon 272.
B*15:496N Deletion Exon 3, 550delC, in codon 160, causes a frameshift and premature stop in codon 189
B*15:528N Point Exon 3, 454-456CAG>TAG, causes E128X, a premature stop in codon 128
B*15:540N Deletion Exon 2, 214delC, in codon 47, causes frameshift and premature stop at codon 52
B*15:544N Deletion Exon 2, 158delA, in codon 29, causes frameshift and premature stop at codon 34
B*15:549N Point Exon 2, 322-324, TAC>TAG, causes X84, a premature stop at codon 84
B*15:562N Deletion Exon 3, 579delC in codon 169, causes frameshifte and premature stop at codon 189
B*15:575N Insertion Exon 3, 424insT in codon 118, causes frameshift and premature stop at codon 152
B*15:584N Point Exon 3, 502-504CAG>TAG, causes X144,a premature stop at codon 144
B*15:596N Point Exon 4, 682-684TGG>TAG, causes X204, a premature stop at codon 204
B*15:604N Deletion Exon 5, 907delC, in codon 279, causes a frameshift and premature stop in codon 294
B*18:17N Point Exon 1, 40-42TCG>TAG, causes W-11X, a premature stop at codon -11 Tissue Antigens (2002) 59:341-343
B*18:23N Point Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180
B*18:74N Point Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161 Tissue Antigens (2014) 83:184-189
B*18:94N Point Exon 2, 291-294TAC>TAA, causes Y74X, a premature stop at codon 74 HLA (2016) 87:31-35
B*18:138N Deletion Exon 3, 468-469delCT, in codons 132-133, causes frameshift and premature stop at codon 195
B*18:154N Point Exon 3, 511-513TGG>TAG, causes X147, a premature stop in codon 147
B*18:182N Deletion Exon 2, 281-282delAC, in codon 70, causes frameshift and premature stop at codon 113.
B*27:59N Point Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 Tissue Antigens (2011) 78:195-202
B*27:64N Point Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 Tissue Antigens (2014) 83:184-189
B*27:65N Point Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 Tissue Antigens (2014) 83:184-189
B*27:66N Deletion Exon 3, 547delT, in codon 159, causes frame shift and a premature stop at codon 189 HLA (2017) 90:171-173
B*27:94N Point Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60
B*27:176N Point Exon 3, 598-600AAG>TAG, causes X176, a premature stop in codon 176
B*27:212N Point Exon 4, 796-798CAG>TAG, causes Q242X, a premature stop at codon 24
B*27:223N Deletion Exon 3, 408delG, in codon 112, causes frameshift and premature stop at codon 126
B*27:225N Point Exon 2, 223-225TGG>TGA, causes W51X, a premature stop in codon 51 HLA (2021) 97:232-233
B*27:243N Point Exon 2, 232-234CAG>TAG, causes X54, a premature stop at codon 54.
B*27:246N Point Exon 2, 256-258CAG>TAG, causes X65, a premature stop at codon 65
B*27:254N Deletion Exon 3, 352-354delAC in codon 94, causes a frameshift and premature stop at codon 195
B*27:261N Insertion Exon 2, 201(1-8)insCGAGTCCG in codon 43, causes a frameshift and premature stop at codon 55
B*27:263N Point Exon 1, 41-43TGG>TGA, causes X-11, a premature stop at codon -11
B*35:40N Deletion Exon 4, 807delA, in codon 245, causes frameshift and premature stop at codon 272 Tissue Antigens (2002) 59:522-524
B*35:53N Deletion Exon 3, 473-477delCCGC, in codons 134-135, causes frameshift and premature stop at codon 155
B*35:129N Point Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 Tissue Antigens (2014) 83:184-189
B*35:130N Point Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27 Tissue Antigens (2014) 83:184-189
B*35:134N Point Exon 4, 782-784TGG>TGA, causes W224X, a premature stop at 244
B*35:145N Insertion Exon 3, 532-533insGCGG, in codon 154 causes a frameshift and premature stop codon at 197
B*35:165N Point Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at 101
B*35:173:01N Point Exon 2, 222-225TGG>TAG, causes W51X, premature stop at codon 51 Tissue Antigens (2014) 83:184-189
B*35:173:02N Point Exon 2, 225G>A, causes W51X, a premature stop at codon 51
B*35:216N Point Exon 2, 331-333 CAG-TAG, causes Q87X, a premature stop at codon 87
B*35:381N Point Exon 3, 424-426TAC>TAA, causes X118, a premature stop in codon 118
B*35:390N Point Exon 1, 40-42TGG>TAG, causes W-11X, a premature stop in codon -11
B*35:427N Insertion Exon 3, 617-618insCG, in codon 183, causes a frameshift and premature stop at codon 190
B*35:430N Deletion Exon 3, 518delC, in codon 149, causes a frameshift and premature stop at codon 156
B*35:448N Deletion Exon 5, 687-693delCCTGGGC in codons 205-207, causes frameshift and premature stop at codon 213
B*35:453N Deletion Exon 2, 286-287delCA in codon 72, causes frameshift and premature stop at codon 113
B*35:456N Point Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257
B*35:459N Point Exon 4, 681-684TGG>TGA, causes W204X, a premature stop at codon 204
B*35:461N Point Exon 3, 562-564, TGC>TGA, causes C164X, a premature stop in codon 164
B*35:507N Point Exon 1, 1-3ATG>TTG, causes a non-synonymous change to the start codon, which may affect expression
B*35:508N Point Exon 2, 232C>T, in codon 54, causes Q54X, a premature stop in codon 54
B*35:513N Point Exon 3, 571-573, TGG>TGA, causes X167, a premature stop at codon 167
B*35:542N Insertion Exon 2, 133insC in codon 21, causes a frameshift and premature stop at codon 114
B*35:551N Deletion Exon 2, 297-304delAGAGAGC in codons 75-77, causes X124, a frameshift and premature stop at codon 124
B*37:03N Point Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89
B*37:30N Point Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133 HLA (2019) 95:128-130
B*37:33N Point Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 Tissue Antigens (2014) 83:184-189
B*37:42N Deletion Exon 2, 213delC, in codon 47, causes a premature stop at codon 52 HLA (2017) 90:79-87
B*37:79N Deletion Exon 2, 286-287delCA, in codon 72, causes a frameshift and premature stop at codon 113.
B*37:82N Deletion Exon 2, 202-203delCC, in codon 43, causes a frameshift and premature stop at codon 113
B*37:86N Deletion Exon 4, 701delC in codon 210, causes frameshift and premature stop at codon 216
B*37:92N Deletion Exon 1, 46delG in codon -9, causes X-6, a frameshift and premature stop at codon -6.
B*38:34N Point Exon 2, 286-288CAG>TAG, causes Q72X, premature stop at codon 72 Tissue Antigens (2014) 83:184-189
B*38:80N Deletion Exon 4, 757-767delGAGCTTGTGGA, in codons 229-232, causes frameshift and premature stop in codon 260
B*38:83N Deletion Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop in codon 113
B*38:165N Point Exon 2, 331-333, CAG>TAG, causes X87, a premature stop at codon 87 HLA (2020) 96:96-97
B*39:25N Deletion Exon 3, 403-404delGC, in codon 111, causes frameshift and premature stop at codon 113 Human Immunology (2018) 79:763-772
B*39:40:01N Point Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 HLA (2020) 96:70-75
B*39:40:02N Point Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164
B*39:87N Point Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 HLA (2017) 90:171-173
B*39:95N Point Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 HLA (2016) 87:31-35
B*39:97N Insertion Exon 3, 604-605insGA, in codon 178, causes frameshift and premature stop at codon 190 HLA (2016) 88:312-313
B*39:116N Point Exon 2, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118
B*39:133N Point Exon 2, 251TGG>TAG, causes W60X, a premature stop in codon 60
B*39:139N Point Exon 3, 469-471TGG>TGA, causes X133, a premature stop in codon 133
B*39:142N Deletion Exon 2, 365delG, in codon 56, causes a frameshift and premature stop at codon 126.
B*39:146N Insertion Exon 2, 88insA, in codon 5, causes a frameshift and premature stop at codon 74
B*39:147N Insertion Exon 2, 258insG, in codon 63, causes a frameshift and premature stop at codon 114
B*39:157N Deletion Exon 2, 107delT, in codon 12, causes frameshift and premature stop at codon 34
B*39:161N Deletion Exon 3, 390-391delCG, in codon 106-107, causes frameshift and premature stop at codon 113
B*39:175N Point Exon 4, 664-666GAG>TAG, in codon 198, causes E198X, a premature stop in codon 198
B*40:22N Point Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 Tissue Antigens (2000) 55:378-380
B*40:118N Point Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 Tissue Antigens (2014) 83:184-189
B*40:142N Deletion Exon 2, 253delG, in codon 60, causes frameshift and premature stop at codon 126
B*40:144N Point Exon 4, 826-828GGA>TGA, causes G252X, a premature stop at codon 252 Tissue Antigens (2011) 78:267-270
B*40:155:01N Insertion Exon 3, 593-594insCAGAA, in codon 174, causes frameshift and premature stop at codon 191 Tissue Antigens (2011) 78:154-155
B*40:155:02N Insertion Exon 3, 593-594insCAGAA, in codon 174, causes frameshift and premature stop at codon 191 HLA (2017) 90:171-173
B*40:216N Deletion Exon 3, 385delC, in codon 105, causes frameshift and a premature stop at codon 126
B*40:256N Deletion Exon 2, 301-302delAG, in codon 77, causes frameshift and a premature stop at codon 113
B*40:263N Point Exon 3, 580582AGA>TGA, causes R170X, a premature stop at codon 170 HLA (2017) 90:171-173
B*40:265N Deletion Exon 2, 189-196delCGCCACGA, causes frameshift and a premature stop at codon 111 HLA (2017) 90:171-173
B*40:286N Point Exon 3, 424-426TAC>TAG, causes Y118X , a premature stop at codon 118 HLA (2017) 90:171-173
B*40:291N Point Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128
B*40:337N Point Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99
B*40:338N Point Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 HLA (2018) 91:303-305
B*40:345N Insertion Exon 3, 508insC, in codon 146, causes frameshift and premature stop codon 196 HLA (2017) 90:79-87
B*40:361N Point Exon 2, 331C>T, causes Q87X, premature stop at codon 87
B*40:372N Insertion Exon 2, 327insA, in codon 85, causes frameshift and a premature stop in codon 85
B*40:399N Deletion Exon 2, 113-116delGGCC, in codons 14 and 15, causes frameshift and premature stop in codon 33
B*40:426N Deletion Exon 2, 321delC, in codon 83, causes a frameshift and premature stop at codon 126
B*40:428N Deletion Exon 2, 279-282delCAAC, in codon 69-70, causes a frameshift and premature stop at codon 125
B*40:438N Deletion Exon 2, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113
B*40:481N Deletion Exon 2, 270delCTCCA in codon 66-68, causes frameshift and premature stop at codon 112
B*40:483N Point Exon 4, 835-837CAG>TAG, causes X255, a premature stop at codon 255 HLA (2022) 99:630-631
B*40:487N Deletion Exon 4, 643delC in codon 191, causes frameshift and premature stop at codon 201
B*40:488N Insertion Exon 2, 160insG, in codon 30, cause a frameshift and premature stop in codon 114
B*40:506N Insertion Exon 2, 81insCTCCTCCTCGCCCCCAGGCTCCCAC, causes a frameshift and premature stop in codon 122
B*40:507N Point Exon 3, 469-471TGG>TGA, causes X133, a premature stop at codon 133
B*40:508N Deletion Exon 2, 253delG, in codon 61, causes a frameshift and premature stop in codon 126 HLA (2022) 99:619-621
B*40:510N Deletion Exon 2, 117delC in codon 15, causes X34, a frameshift and premature stop at codon 34
B*40:511N Point Exon 2, 337-339GAG>TAG, causes X89, a premature stop at codon 89 HLA (2022) 99:619-621
B*40:514N Point Exon 2, 232>234CAG>TAG, causes X54, a premature stop at codon 54
B*41:45N Insertion Exon 2, 279-280insGAGACACAGATCTCCAAGACC, causes no frameshift but allele is shown to be non-expressed HLA (2016) 88:50-51
B*44:19N Deletion Exon 1, 5delT, in codon -23, causes frameshift and a premature stop at codon -6 Tissue Antigens (2000) 56:441-445
B*44:23:01:01N Point Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 European Journal of Immunogenetics (2003) 30:385-386
Tissue Antigens (2003) 61:20-48
B*44:23:01:02N Point Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141
B*44:52N Deletion Exon 3, 492-505delTCAGATCACCCAGC, in codons 140-145, causes frameshift and premature stop at codon 191
B*44:56N Point Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 Tissue Antigens (2009) 73:607-609
B*44:58N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 Tissue Antigens (2009) 74:238-240
B*44:61N Point Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46
B*44:108N Point Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 Tissue Antigens (2012) 79:50-57
B*44:149N Point Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop at codon 96 Tissue Antigens (2014) 83:184-189
B*44:171N Point Exon 2, 259-261GAG>TAG, causes E63X, a premature stop at codon 63 Tissue Antigens (2014) 83:184-189
B*44:195N Point Exon 3, 571-573TCG>TAG, causes S167X, a premature stop at codon 167 HLA (2016) 87:31-35
B*44:198N Point Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118 HLA (2016) 87:31-35
B*44:217N Point Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115
B*44:237N Deletion Exon 2, 286-287delCA, in codon 72, causes frameshift and premature stop at codon 113 HLA (2016) 88:126-127
B*44:267N Insertion Exon 4, 627insC, in codon 185, causes frameshift and premature stop at codon 196 HLA (2018) 91:187-194
B*44:303N Point Exon 4, 721-723TGG>TAG, causes X217, a premature stop in codon 217.
B*44:306N Point Exon 1, 19-21CGA>TGA, causes X-18, a premature stop at codon -18
B*44:309N Insertion Exon 1, 47insG, in codon -9, causes a frameshift and premature stop at codon 114.
B*44:310N Insertion Exon 4, 627insC, in codon 185, causes a frameshift and premature stop at codon 196.
B*44:314N Insertion Exon 3, 584insA, in codon 171, causes a frameshift and premature stop at codon 171
B*44:328N Point Exon 2, 235-237GAG>TAG, causes X55, a premature stop in codon 55
B*44:333N Insertion Exon 3, 515insA, in codon 148, causes a frameshift and premature stop in codon 196
B*44:334N Point Exon 4, 679-681TGC>TGA, causes X203, a premature stop at codon 203
B*44:341N Insertion Exon 4, 607-626insAAAGACACATGTGACCCCCC, in codon 185, causes frameshift and premature stop at codon 196
B*44:345N Deletion Exon 2, 313-331delCTCCGCGGCTACTACAACC in codons 81-87, causes frameshift and premature stop at codon 120 HLA (2020) 96:220-221
B*44:354N Insertion Exon 2, 146insT, causes a frameshift and premature stop at codon 114
B*44:438N Insertion Exon 2, 319-320insAC in codon 83, causes frameshift and premature stop at codon 126
B*44:448N Point Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128
B*44:449N Deletion Exon 2, 212delC in codon 47, causes frameshift and premature stop at codon 52
B*44:466N Point Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression
B*44:512N Deletion Exon 3, 626delC in codon 185, causes frameshift and premature stop at codon 189
B*44:523N Deletion Exon 4, 626delC, in codon 185, causes a frameshift and premature stop in codon 189
B*44:544N Point Exon 3, 511TGG>TGA, causes W147X, a premature stop in codon 147 HLA (2022) 99:631-633
B*45:28N Deletion Exon 2, 246delG, in codon 58, causes a frameshift and premature stop at codon 116
B*46:07N Point Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 Tissue Antigens (2006) 68:518-520
B*46:15N Point Exon 4,736-738GAG>TAG, causes E222X, a premature stop at codon 222
B*46:41N Deletion Exon 2, 268-280delAGCCGAGGCACA, in codon 66-70, causes a frame shift and premature stop codon at 72 HLA (2020) 95:212-213
B*46:55N Point Exon 3, 469-471TGG>TAG, causes W133X, a premature stop codon at 133 HLA (2017) 90:171-173
B*46:79N Deletion Exon 2, 269delA in codon 66, causes frameshift and premature stop at codon 76
B*46:95N Point Exon 1, 1-3ATG>ACG, causes mutation in the start codon, which may affect expression
B*46:98N Insertion Exon 3, 460insC in codon 130, cause a frameshift and premature stop at codon 152
B*49:19N Point Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133
B*49:60N Deletion Exon 2, 217delG, in codon 49, causes frameshift and premature stop at codon 52
B*50:72N Point Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop in codon 65
B*51:11N Insertion Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 Tissue Antigens (2001) 57:369-372
B*51:27N Point Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144 Tissue Antigens (2002) 60:262-265
B*51:41N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75
B*51:44N Point Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon 65
B*51:98N Point Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 Tissue Antigens (2014) 83:184-189
B*51:110N Point Exon 2, 325-327TAC>TAG, causes Y85X, a premature stop codon 85 Tissue Antigens (2014) 83:184-189
B*51:118N Deletion Exon 2, 264-265delAC, in codons 64-65, causes frameshift and premature stop at codon 113
B*51:149N Deletion Exon 3, 611delA, in codon 180, causes frame shift and premature stop codon at codon 189
B*51:178N Point Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 HLA (2016) 87:31-35
B*51:184N Point Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32
B*51:235N Point Exon 3, 511-513TGG>TAG, causes X147, a premature stop in codon
B*51:245N Point Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65
B*51:256N Deletion Exon 4, 743-744delAA, in codon 224, causes a frameshift and premature stop in codon 228
B*51:264N Deletion Exon 4, 713delC, in codon 216, causes a frameshift and premature stop at codon 215.
B*51:273N Deletion Exon 3, 380delT, in codon 103, causes a frameshift and premature stop at codon 126
B*51:287N Deletion Exon 3, 523delC in codon 151, causes frameshift and premature stop at codon 156
B*51:306N Deletion Exon 3, 393delG, in codon 107, causes a frameshift and premature stop in codon 126
B*51:313N Insertion Exon 3, 507insC in codon 146, causes frameshift and premature stop at codon 152
B*51:318N Deletion Exon 2, 300delGA, causes a frameshift and premature stop in codon 113.
B*51:325N Deletion Exon 3, 474delC in codon 134, causes frameshift and premature stop at codon 156
B*51:344N Point Exon 2, 91-93TAT>TAG, causes Y7X, a premature stop in codon 7
B*51:357N Deletion Exon 2, 127delG, in codon 19, causes a frameshift and premature stop at codon 34
B*51:361N Deletion Exon 4, 688delC, in codon 206, causes a frameshift and premature stop in codon 215
B*51:365N Point Exon 4, 724-726CAG>TAG, causes X218, a premature stop at codon 218
B*52:49N Point Exon 3, 601-603GAG>TAG, in codon 177, causes E177X, a premature stop at codon 177 HLA (2021) 98:553-555
B*52:89N Deletion Exon 2, 286-287delCA in codon 72, causes frameshift and premature stop at codon 113
B*52:94N Deletion Exon 4, 626delC, in codon 185, causes frameshift and premature stop at codon 189
B*52:96N Point Exon 3, 493-495, CAG>TAG, causes X141, a premature stop at codon 141
B*52:103N Point Exon 4, 892-894, TGG>TAG causes X274, a premature stop at codon 274
B*52:110N Point Exon 3, 454-456GAG>TAG, causes X128, a premature stop at codon 128
B*53:48N Point Exon 3, 426C>A, causes Y118X, a premature stop at codon 118
B*54:05N Deletion Exon 2, 212-232delCGCGGGCGCCGTGGATAGAGC, in codons 47-54, causes no frameshift but deletion of 7 amino acids
B*54:08N Point Exon 3, 553-554GAG>TAG, causes E161X, a premature stop at codon 161 Tissue Antigens (2006) 68:182-
B*55:55N Point Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159 Tissue Antigens (2014) 83:184-189
B*55:83N Point Exon 4, 799A>T, causes K243X, a premature stop at codon 243 HLA (2017) 89:119-120
B*55:89N Insertion Exon 4, 600insA in codon 176, causes frameshift and premature stop in codon 196
B*55:97N Deletion Exon 1, 41delC, in codon -9, causes a frameshift and premature stop in codon -6.
B*55:117N Deletion Exon 4, 643delC, in codon 191, causes a frameshift and premature stop in codon 201 HLA (2021) 98:480-481
B*55:118N Deletion Exon 2, 268-273delATCTA, in codon 66, causes a frameshift and premature stop at codon 72
B*55:125N Point Exon 1, 1-3ATG>ATA, causes mutation in the start codon, which may affect expression
B*55:132N Deletion Exon 4, 867delG in codon 265, causes X272, a premature stop at codon 272
B*56:19N Point Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164
B*56:28N Point Exon 2, 247-249TGG>TGA, causes W59X, a premature stop at codon 59
B*56:38N Point Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32 Tissue Antigens (2014) 83:184-189
B*56:77N Point Exon 3, 571-573, TGG>TGA, causes X167, a premature stop at codon 167
B*57:28N Point Exon 3, 418-420TAC>TAG, causes Y116X, a premature stop at codon 116 International Journal of Immunogenetics (2010) 37:299-300
B*57:79N Deletion Exon 4, 876delG, in codon 268, causes frameshift and premature stop at codon 272
B*57:122N Point Exon 3, 513-515TGG>TGA, causes W147X, a premature stop at codon 147
B*57:130N Deletion Exon 4, 863delA in codon 264, causes frameshift and premature stop at codon 272
B*57:139N Insertion Exon 3, 617-618inCG in codon 183, causes frameshift and premature stop at codon 190
B*57:142N Point Exon 3, 469-471TGG>TAG, in codon 133, causes W133X, a premature stop in codon 133 HLA (2021) 98:380-381
B*57:143N Point Exon 3, 502-504CAG>TAG, causes X144, a premature stop at codon 144
B*57:162N Insertion Exon 2, 81insAC in codon 3, causes a frameshift and premature stop at codon 6
B*58:10N Deletion Exon 3, 366delG, in codon 98, causes frameshift and premature stop at codon 126
B*58:17N Deletion Exon 3, 311delA, in codon 80, causes frameshift and premature stop at codon 126 Tissue Antigens (2009) 73:364-372
B*58:31N Deletion Exon 4, 872-894delCGAAGCCCCTCACCCTGAGATGG, causes frameshift and premature stop at codon 300 HLA (2017) 90:171-173
B*58:39N Point Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46 Tissue Antigens (2014) 83:184-189
B*58:72N Insertion Exon 3, 508insC, in codon 146, causes frameshift and premature stop at codon 196 HLA (2016) 87:54-55
B*58:93N Point Exon 3, 367-369TAT>TAA, causes Y99X, a premature stop in codon 99
B*58:94N Point Exon 3, 571-573TGG>TGA, causes X167, a premature stop in codon 167
B*58:128N Insertion Exon 2, 320insG in codon 83, causes frameshift and premature stop at codon 114.
B*58:130N Insertion Exon 4, 626insC in codon 185, causes frameshift and premature stop at codon 196
B*58:133N Deletion Exon 4, 759delG in codon 229, causes a frameshift and premature stop in codon 272
B*59:10N Deletion Exon 3, 506delG, in codons 145, causes frameshift and premature stop at codon 156
B*81:04N Point Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 Tissue Antigens (2009) 73:364-372
C*01:37N Point Exon 3, 361-363TGG>TGA, causes W97X, a premature stop at codon 97
C*01:56N Point Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87
C*01:69N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 Tissue Antigens (2014) 83:184-189
C*01:86N Deletion Exon 3, 421delG, in codon 117, causes frameshift and premature stop at codon 126 HLA (2017) 90:171-173
C*01:89N Point Exon 4, 841-843TAC>TAG, causes Y257X, a premature stop at codon 257 HLA (2017) 90:171-173
C*01:98N Deletion Exon 2, 285-286delAC, in codons 72-73, causes frameshift and premature stop at codon 73
C*01:109N Point Exon 4, 682-684TGG>TAG, in codon 204, causes S204X, a premature stop at codon 204 HLA (2017) 89:252-253
C*01:111N Point Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133
C*01:117N Insertion Exon 2, 203-204insA, in codon 44, causes frameshift and premature stop at codon 74 HLA (2018) 92:304-309
C*01:137N Deletion Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113 HLA (2018) 91:187-194
C*01:143N Point Exon 3, 585C>A, causes Y171X, a premature stop at codon 171
C*01:145:01N Point Exon 3, 420C>A, causes Y116X, a premature stop at codon 116
C*01:145:02N Point Exon 3, 418-420, TAA>TAG, causes X116, a premature stop at codon 116
C*01:171N Deletion Exon 2, 319delG, in codon 83, causes a frameshift and premature stop at codon 126
C*01:181N Point Exon 4, 829-831GAA>TAA causes E253X, a premature stop at codon 25
C*01:211N Deletion Exon 2, 240delG in codon 56, causes frameshift and premature stop at codon 76
C*01:222N Deletion Exon 3, 525delT, causes a frameshift and premature stop in codon 189.
C*01:224N Point Exon 3, 411T>A, in codon 113, causes Y113X, a premature stop in codon 113 HLA (2022) 99:640-641
C*01:228N Deletion Exon 2, 265-267delCA, causes a frameshift and premature stop in codon 73
C*01:229N Insertion Exon 2, 294insTGAC, causes a frameshift and premature stop in codon 75
C*01:231N Deletion Exon 3, 402-425delCCGCGGGTATGACCAGTACGCCT in codon 110, causes a frameshift and premature stop at codon 144.
C*02:38:01N Point Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
C*02:38:02N Point Exon 3, 367-369TAC>TAG, causes X99, a premature stop at codon 99
C*02:52N Point Exon 2, 151-153TAC>TAA, causes Y27X, premature stop at codon 27 Tissue Antigens (2014) 83:184-189
C*02:92N Deletion Exon 3, 382delG, in codon 104, causes frameshift and premature stop at codon 126 HLA (2017) 90:79-87
C*02:105N Insertion Exon 2, 224-230insTCGCCGT, in codon 51, causes frameshift and premature stop at codon 76
C*02:121N Point Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85
C*02:135N Deletion Exon 3, 538-539delCG, in codon 154, causes frameshift and premature stop in codon 195 HLA (2018) 91:538-539
C*02:150N Point Exon 4, 742-744CAA>TAA, causes X224, a premature stop in codon 224
C*02:165N Deletion Exon 2, 265-266delCA, in codon 65, causes a frameshift and premature stop at codon 73
C*02:169N Insertion Exon 4, 696insG, in codon 205, causes frameshift and premature stop in codon 31
C*02:192N Point Exon 3, 571-573, TGG>TAG, causes X167, a premature stop at codon 167
C*02:193N Point Exon 4, 682-684TGG>TAG, causesW 204X, a premature stop in codon 204
C*02:216N Point Exon 3, 454-456GAG>TAG, causes X128, a premature stop at codon 128
C*03:03:01:50N Point Intron 2, 718A>G, causes a mutation in the splice site preceeding exon 3
C*03:03:01:52N Point Intron 1, 203G>A, affecting the splice site for intron 2 HLA (2022) 99:50-51
C*03:20N Point Exon 1, 19-21CGA>TGA, causes R-18X, a premature stop at codon -18
C*03:23N Point Exon 3, 406G>A, causes incorrect splicing and the deletion of 64bp, resulting in a frameshift and premature stop codon HLA (2018) 92:304-309
HLA (2020) 95:555-560
C*03:121N Point Exon 3, 511-513TGG>TGA, causes W147X, premature stop at codon 147
C*03:189N Point Exon 2, 151-153TAC>TAG, causes Y27X, a premature stop at codon 27
C*03:201N Point Exon 3, 583-585TAC>TAG, causes Y171X, a premature stop at codon 171 HLA (2017) 90:171-173
C*03:208N Point Exon 2, 271-273TAC>TAA, causes Y67X, a premature stop at codon 67 HLA (2017) 90:171-173
C*03:224N Point Exon 4, 727-729TGG>TAG, causes W219X, a premature stop at codon 219 HLA (2017) 90:171-173
C*03:229N Point Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 HLA (2017) 90:171-173
C*03:265N Point Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118
C*03:277N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75
C*03:316N Deletion Exon 2, 286-287delCA, causes frameshift and premature stop at codon 73 HLA (2019) 95:128-130
C*03:318N Point Exon 3, 418-420TAC>TAA, causes Y116X, a premature stop at codon 116 HLA (2017) 90:79-87
HLA (2017) 90:79-87
C*03:323N Point Exon 2, 280-282CAG>TAG, causes Q70X, a premature stop at codon 70
C*03:363N Point Exon 2, 225G>A, causes W51X, a premature stop at codon 51
C*03:366N Deletion Exon 4, 668-678delCCACCCTGAGG, in codons 199-202, causes frameshift and premature stop at codon 225 HLA (2018) 91:187-194
C*03:377N Deletion Exon 2, 299-302delTGAG, in codons 76-77, causes frameshift and premature stop in codon 125
C*03:380N Point Exon 4, 895-898GAG>TAG, causes E275X, a premature stop in codon 275
C*03:391N Insertion Exon 2, 370insT, in codon 100, causes a frameshift and premature stop in codon 114
C*03:392N Deletion Exon 2, 236delA, in codon 55, causing a frameshift and a premature stop in codon 76
C*03:396:01N Point Exon 2, 325-327TAC>TAG, causes X85, a premature stop in codon 85
C*03:396:02N Point Exon 2, 325-327TAG>TAA, causes X85, a premature stop in codon 85
C*03:421N Point Exon 1, 43-45GGA>TGA, causes X-10, a premature stop in codon -10
C*03:424N Point Exon 4, 721-723TGG>TAG, causes X217, a premature stop in codon 217
C*03:432N Point Exon 4, 721-723TGG>TGA, causes X217, a premature stop in codon 217
C*03:444N Deletion Exon 3, 387delC, in codon 105, causes a frameshift and premature stop at codon 126
C*03:445N Deletion Exon 3, 586delC, in codon 172, causes a frameshift and premature stop at codon 172
C*03:446N Insertion Exon 3, 388insC, in codon 106, causes a frameshift and premature stop at codon 114.
C*03:447N Deletion Exon 3, 466delT, in codon 132, causes a frameshift and premature stop at codon 156
C*03:449N Insertion Exon 2, 80insC, in codon 3, causes a frameshift and premature stop at codon 74
C*03:462N Insertion Exon 3, 394insA, in codon 108, causes a frameshift and premature stop at codon 114.
C*03:463N Deletion Exon 3, 421-422delGC, in codon 117, causes frameshift and premature stop in codon 151
C*03:470N Point Exon 1, 19C>T, in codon -18, causes CGA>TGA, a premature stop at codon -18
C*03:508N Deletion Exon 2, 145delG in codon 25, causes frameshift and premature stop at codon 76
C*03:509N Deletion Exon 2, 149delG in codon 26, causes frameshift and premature stop at codon 76
C*03:510N Point Exon 1, 127-129, GAG>TAG, causes X19, a premature stop at codon 19
C*03:511N Insertion Exon 2, 241insG in codon 241, causes frameshift and premature stop at codon 74
C*03:531N Deletion Exon 2, 265delCA, in codon 65, causes a frameshift and premature stop in codon 73
C*03:560N Deletion Exon 4, 679delT in codon 203, causes a frameshift and premature stop at codon 215 HLA (2022) 99:392-394
C*03:571N Insertion Exon 3, 430insT, in codon 120, causes a frameshift and premature stop in codon 152
C*03:618N Point Exon 1, 67-69TGG>TGA, causes W-2X, a premature stop in codon -2
C*03:619N Insertion Exon 2, 239insG in codon 55, causes a frameshift and premature stop at codon 74
C*04:09N Deletion Exon 7, 1095delA, in codon 341, causes frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 32 amino acids Human Immunology (2002) 63:295-300
Tissue Antigens (2002) 59:95-100
Tissue Antigens (2002) 59:95-100
Human Immunology (2013) 74:325-329
C*04:61N Deletion Exon 7, 1095delA, in codon 341, causes frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 32 amino acids Tissue Antigens (2014) 83:184-189
C*04:88N Point Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 Tissue Antigens (2014) 83:184-189
C*04:93N Point Exon 3, 373-375TGC>TGA, causes C101X, premature stop at codon 101 Tissue Antigens (2014) 83:184-189
C*04:95N Point Exon 3, 547-549TAC>TAA, causes W159X, premature stop at codon 159 Tissue Antigens (2014) 83:184-189
C*04:105N Point Exon 2, 247-249TAT>TAG, causes Y59X, a premature stop at codon 59 Tissue Antigens (2014) 83:184-189
C*04:115N Point Exon 2, 49-51GAG>TAG, causes A49X, a premature stop at codon 49 Tissue Antigens (2014) 83:184-189
C*04:123N Point Exon 2, 115-117CAG>TAG, causes Q115X, a premature stop at codon 115
C*04:170N Point Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85
C*04:173N Point Exon 2, 268-270AAG>TAG, causes K66X, a premature stop at codon 66
C*04:191N Point Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60
C*04:203N Point Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147
C*04:205N Point Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54
C*04:215N Point Exon 2, 271-273TAC>TAG, causes Y67X, a premature stop at codon 67
C*04:217N Deletion Exon 2, 208delG, in codon 46 causes frameshift and premature stop at codon 76
C*04:225N Point Exon 2, 265-267CAG>TAG, causes E65X, a premature stop at codon 65
C*04:233N Point Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19
C*04:234N Point Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 HLA (2017) 90:79-87
C*04:236N Deletion Exon 2, 218delA, in codon 49 causes frameshift and premature stop at codon 76 HLA (2017) 90:79-87
C*04:253N Point Exon 3, 532-534GAG>TAG causes R154X, a premature stop at codon 154
C*04:255N Insertion Exon 2, 194-195insC, in codon 41, causes frameshift and premature stop at codon 74
C*04:279N Point Exon 2, 295C>T, causes R75X, a premature stop at codon 75
C*04:300N Point Exon 2, 271-273TAC>TAG, causes Y67X, a premature stop at codon 67
C*04:305N Deletion Exon 3, 496delA, in codon 142, causes a frameshift and a premature stop in codon 189
C*04:309N Point Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85
C*04:349N Insertion Exon 3, 518-519insCG, in codon 150, causes a frameshift and premature stop at codon 190
C*04:350N Deletion Exon 2, 267-274delGAAGTACA, in codons 65-68, causes a frameshift and premature stop at codon 71
C*04:362N Point Exon 2, 151-153TAC>TAG, causes X27, a premature stop at codon 27
C*04:364N Insertion Exon 2, 267insA, in codon 65, causes a frameshift and premature stop at codon 74
C*04:365N Deletion Exon 2, 331delC, in codon 87, causes a frameshift and premature stop at codon 126
C*04:369N Deletion Exon 3, 568delG, in codon 166, causes a frameshift and premature stop at codon 189.
C*04:371N Point Exon 2, 112-114TGG>TGA, causes W14X, a premature stop in codon 14
C*04:374N Deletion Exon 3, 365delT, in codon 98, causes a frameshift and premature stop in codon 126
C*04:377N Deletion Exon 2, 127delG in codon 19, causes frameshift and premature stop at codon 76
C*04:385N Deletion Exon 3, 393delG in codon 107, causes frameshift and premature stop at codon 126
C*04:396N Insertion Exon 2, 239insG, in codon 56, causes a framshift and premature stop at codon 74
C*04:410N Point Exon 2, 274-276, AAG>TAG, causes X68, a premature stop at codon 68
C*04:411N Point Exon 4, 727-729, TGG>TAG, causes X219, a premature stop at codon 219
C*04:417N Deletion Exon 2, 159delC in codon 29, causes frameshift and premature stop at codon 76
C*04:436N Point Exon 2, 250-252TGG>TAG, causes X60, a premature stop at codon 60
C*04:452N Point Exon 4, 243-245TGG>TAG, causes W244X, a premature stop in codon 244
C*04:486N Insertion Exon 2, 151insT in codon 27, causes a frameshift and premature stop at codon 74
C*05:07N Deletion Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113 HLA (2017) 90:79-87
C*05:48N Point Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32 Tissue Antigens (2014) 83:184-189
C*05:91N Point Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89
C*05:92N Point Exon 2, 175-177CAG>TAG, causes Q35X, a premature stop at codon 35 HLA (2017) 90:79-87
C*05:99N Deletion Exon 3, 384delG, in codon 104, causes frameshift and premature stop at codon 126 Tissue Antigens (2014) 84:420-421
C*05:113N Deletion Exon 2, 93-94delTT, in codons 7-8, causes frameshift and premature stop at codon 73
C*05:128N Deletion Exon 3, 461-474delTGCGCTCCTGGACC, in codons 130-134, causes frameshift and premature stop at codon 147 HLA (2018) 92:304-309
C*05:153N Point Exon 1, 61G>T, causes E-4X, premature stop at codon -4
C*05:154N Point Exon 3, 514G>T, causes E148X, premature stop at codon 148
C*05:169N Point Exon 2, 244-246GAG>TAG, causes X58, a premature stop in codon 58
C*05:175N Point Exon 3, 358-360CAG>TAG, causes X94, a premature stop in codon 96
C*05:180N Point Exon 3, 424-426TAC>TAG, causes X118, a premature stop in codon 118
C*05:208N Insertion Exon 3, 507insC, in codon 146, causes a frameshift and premature stop at codon 152
C*05:213N Insertion Exon 3, 466insT, in codon 132, causes a frameshift and premature stop at codon 152
C*05:239N Point Exon 4, 682-684, TGG>TAG, causes W204X, a premature stop at codon 204.
C*05:244N Point Exon 3, 511TGG>TAG, causes W147X, a premature stop in codon 147
C*05:251N Insertion Exon 3, 548insTA in codon 159, causes frameshift and premature stop at codon 190
C*05:253N Point Exon 2, 280-282CAG>TAG, in codon 70, causes Q70X, a premature stop in codon 70
C*05:257N Deletion Exon 3, 563delG in codon 164, causes frameshift and premature stop at codon 189
C*05:259N Point Exon 3, 469-471TGG>TAG, causes W133X, a premature stop in codon 133
C*05:260N Point Exon 4, 697-698TAC>TAA, causes Y209X, a premature stop in codon 209
C*05:263N Deletion Exon 2, 246delG, in codon 58, causes a frameshift and premature stop in codon 76
C*05:264N Point Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop in codon 180
C*05:270N Point Exon 3, 415C>T, in codon 115, causes Q115X, a premature stop in codon 115
C*05:271N Point Exon 3, 493C>T, in codon 141, causes Q141X, a premature stop in codon 141
C*06:16N Deletion Exon 3, 499-500delAC, in codon 143, causes a frameshift and premature stop at codon 151 Tissue Antigens (2007) 70:441-442
HLA (2017) 90:79-87
C*06:46N Point Exon 4, 742-744CAA>TAA, causes Q224X, a premature stop at codon 224
C*06:49N Point Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101 Tissue Antigens (2014) 83:184-189
C*06:79N Point Exon 3, 538-540TGG>TGA, causes R156X, a premature stop at codon 156
C*06:116N Deletion Exon 3, 615-619delCGCGG, in codon 181, causes a premature stop at codon 194 HLA (2017) 90:171-173
C*06:128N Point Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54
C*06:134N Point Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65
C*06:152N Point Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128
C*06:171:01:01N Point Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 HLA (2017) 90:79-87
C*06:171:01:02N Point Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85
C*06:175N Point Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147
C*06:208N Point Exon 3, 585C>G, causes Y171X, a premature stop at codon 171
C*06:211:01:01N Point Exon 4, 894G>A, causes W274X, a premature stop at codon 274 HLA (2019) 94:347-359
C*06:211:01:02N Point Exon 4, 894G>A, causes W274X, a premature stop at codon 274
C*06:215N Deletion Exon 3, 568delG, in codon 166, causes frameshift and premature stop in codon 189
C*06:220N Insertion Exon 3, 572insT, in codon 167, causes a frameshift and a premature stop in codon 196
C*06:257N Insertion Exon 3, 520insG, in codon 150, causes a frameshift and premature stop at codon 189
C*06:259N Insertion Exon 2, 164insC, in codon 31, causes a frameshift and premature stop at codon 74
C*06:263N Deletion Exon 3, 488delC, in codon 139, causes a frameshift and a premature stop in codon 189
C*06:267N Insertion Exon 3, 559-560insGC, in codon 163, causes frameshift and premature stop at codon 190
C*06:281N Deletion Exon 2, 269delA, in codon 66, causes frameshift and premature stop at codon 76.
C*06:301N Point Exon 3, 468-470, TGG>TAG, causes X133, a premature stop at codon 133
C*06:309N Point Exon 2, 229-231GAG>TAG, causes E53X, a premature stop in codon 53
C*06:316N Point Exon 3, 598-601AAG>TAG, causes K176X, a premature stop in codon 176
C*06:323N Point Exon 3, 562-564TGC>TGA, in codon 164, causes C164X, a premature stop in codon 164
C*06:338N Insertion Exon 3, 609insG in codon 180, causes frameshift and premature stop at codon 196
C*06:347N Deletion Exon 3, 395delG, in codon 108, causes a frameshift and premature stop in codon 126
C*06:350N Deletion Exon 3, 418delT in codon116, causes a frameshift and premature stop at codon 126
C*06:353N Insertion Exon 2, 247insGAGT in codon 59, causes a frameshift and premature stop at codon 59
C*06:357N Point Exon 2, 73-75TGC>TGA, causes X1, a premature stop at codon 1
C*06:359N Insertion Exon 4, 843insA in codon 257, causes a frameshift and premature stop at codon 257
C*07:02:01:17N Point Intron 3, g710T>A, causes incorrect splicing and the deletion of 110bp, resulting in a frameshift and premature stop codon HLA (2018) 92:56-57
C*07:32N Insertion Exon 3, 560-561insCGCAGAT, in codon 163, causes frameshift and premature stop at codon 198 HLA (2017) 90:79-87
C*07:33N Deletion Exon 2, 92delA, in codon 7, causes frameshift and premature stop at codon 76 Tissue Antigens (2008) 71:560-563
C*07:55N Point Exon 3, 409-411TAT>TAG, causes Y113X, a premature stop at codon 113 Tissue Antigens (2012) 79:139-
Human Immunology (2018) 79:763-772
C*07:61N Point Exon 2, 280-282CAG>TAG, causes Q70X, a premature stop at codon 70
C*07:98N Point Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 Tissue Antigens (2014) 83:184-189
C*07:104N Point Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 Tissue Antigens (2014) 83:184-189
C*07:152N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 Tissue Antigens (2014) 83:184-189
C*07:164N Point Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85
C*07:191N Point Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 Tissue Antigens (2014) 83:184-189
C*07:198N Point Exon 2, 202-204AGA>TGA, causes R44X, a premature stop at codon 44
C*07:227N Point Exon 2, 124-126GGA>TGA, causes 18GX, a premature stop at codon 18
C*07:264N Point Exon 3, 535-537CAG>TAG, causes Q155X, a premature stop at codon 155
C*07:329N Point Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 HLA (2016) 87:31-35
C*07:347N Deletion Exon 3, 537delG, in codon 155, causes frameshift and premature stop at codon 156 HLA (2017) 90:171-173
C*07:350N Insertion Exon 4, 706-707insG, in codon 212, causes a frame shift HLA (2017) 90:171-173
C*07:393N Deletion Exon 3, 564delC, in codon 158, causes frameshift and premature stop at codon 189 Tissue Antigens (2015) 85:511-512
C*07:437N Deletion Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop at codon 73
C*07:451N Point Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85
C*07:452N Point Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46
C*07:476N Point Exon 2, 265-267CAG>TAG, causes Q85X, a premature stop at codon 85
C*07:483N Point Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161 HLA (2017) 90:79-87
C*07:484N Point Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115
C*07:491:01N Point Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133
C*07:491:02N Point Exon 3, 469-471TAG>TGA, causes X133X, a premature stop at codon 133 HLA (2017) 90:79-87
C*07:507N Point Exon 2, 259-261GAG>TAG, causes E63X, a premature stop at codon 63 HLA (2017) 90:79-87
C*07:551N Deletion Exon 3, 596-606delGGAAGGAGACG causing frameshift and premature stop at codon 192 HLA (2017) 90:79-87
C*07:593N Point Exon 4, 893G>A, causes W148X, premature stop at codon 148
C*07:600:01N Point Exon 2, 224G>A, causes W51X, a premature stop at codon 51
C*07:600:02N Point Exon 2, 225G>A, causes W51X, a premature stop at codon 51
C*07:603N Point Exon 2, 225G>A, causes W51X, at premature stop at codon 51
C*07:633N Point Exon 3, 562-564TGC>TGA, causes X164, a premature stop in codon 164
C*07:672N Insertion Exon 2, 96-97insTT, in codon 8, causes frameshift and premature stop in codon 77
C*07:675N Point Exon 4, 856-858CAG>TAG, causes X262, a premature stop in codon 262
C*07:686N Point Exon 4, 721-723TGG>TAG, causes X217, a premature stop in codon 217
C*07:690N Point Exon 3, 571-573TGG>TGA, causes X167, a premature stop in codon 167
C*07:702N Point Exon 2, 426-428TAC>TAG, causes X118, a premature stop at codon 118
C*07:726N Deletion Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop in codon 113
C*07:733N Point Exon 3, 454-456GAG>TAG, causes X128, a premature stop at codon 128
C*07:743N Deletion Exon 4, 871delC, in codon 266, causes a frameshift and premature stop at codon 272
C*07:745N Deletion Exon 2, 177-178delGT, in codon 35-36, causes a frameshift and premature stop at codon 73
C*07:746N Deletion Exon 3, 359-365delAGAGGAT, in codons 96-98, causes a frameshift and premature stop at codon 124
C*07:747N Deletion Exon 3, 352-353delAC, in codon 94, causes a frameshift and premature stop at codon 113.
C*07:749N Deletion Exon 2, 216delT, in codon 51, causes a frameshift and premature stop at codon 76
C*07:750N Insertion Exon 2, 242insC, in codon 57, causes a frameshift and premature stop at codon 74.
C*07:751N Insertion Exon 2, 185insA, in codon 38, causes frameshift and premature stop at codon 74
C*07:752N Insertion Exon 2, 204insA, in codon 45, causes frameshift and premature stop at codon 74
C*07:753N Insertion Exon 2, 173insT, in codon 34 causes a frameshift and premature stop at codon 74.
C*07:754N Insertion Exon 3, 584insA, in codon 171, causes a frameshift and premature stop at codon 171
C*07:770N Point Exon 3, 598-600AAG>TAG, causes K176X, a premature stop at codon 176
C*07:773N Insertion Exon 2, 267insT, in codon 66, causes frameshift and premature stop at codon 66
C*07:776N Deletion Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop in codon 113
C*07:787N Insertion Exon 3, 584insA in codon 171, causes frameshift and premature stop at codon 171
C*07:796N Deletion Exon 4, 737delA in codon 222, causes frameshift and premature stop at codon 272
C*07:797N Point Exon 4, 892-894TGG>TGA, causes W274X, a premature stop at codon 274
C*07:804N Deletion Exon 3, 565delG, in codon 165, causes frameshift and premature stop at codon 189.
C*07:807N Insertion Exon 4, 899insC, in codon 276, causes frameshift and premature stop at codon 310
C*07:820N Point Exon 3, 508-510, AAG>TAG, causes X146, a premature stop at codon 146
C*07:821N Insertion Exon 2, 166-167insGC, in codon 32, causes frameshift and premature stop at codon 77
C*07:833N Point Exon 4, 697-699, TAC>TAA causes X209, a premature stop at codon 209
C*07:839N Deletion Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113 HLA (2020) 95:142-143
C*07:840N Point Exon 4, 700-702, TAC>TAA, causes X209, a premature stop at codon 209 HLA (2020) 96:99-101
C*07:849N Deletion Exon 2, 267delG in codon 65, causes frameshift and premature stop at codon 76
C*07:856N Point Exon 3, 580-582, AGA>TGA, causes X170, a premature stop at codon 170
C*07:863N Deletion Exon 3, 388-389delGA, causes X113, a frameshift and premature stop at codon 113.
C*07:881N Deletion Exon 3, 434delA in codon 121, causes a frameshift and premature stop at codon 126
C*07:886N Point Exon 4, 829-831CAA>TAA, causes E253X, a premature stop in codon 253
C*07:889N Deletion Exon 2, 185delG, in codon 38, causes a frameshift and premature stop in codon 76
C*07:934N Point Exon 4, 736-738GAG>TAG, causes X222, a premature stop at codon 222.
C*07:936N Deletion Exon 2, 92delA, in codon 7, causes frameshift and premature stop at codon 76
C*07:954N Insertion Exon 2, 295insC in codon 75, causes frameshift and premature stop at codon 114
C*07:963N Point Exon 2, 271-273TAC>TAG, causes Y67X, a premature stop in codon 67
C*07:970N Deletion Exon 2, 91-128delTATTTCGACACCGCCGTGTCCCGGCCCGGCCGCGGAG in codon 7, causes a frameshift and premature stop at codon 64
C*07:981N Point Exon 3, 469-471, TGG>TGA, causes X133, a premature stop at codon 133. Protein changes after premature stop
C*07:984N Insertion Exon 3, 581insG in codon 170, causes frameshift and premature stop at codon 196
C*07:1001N Deletion Exon 1, 53delCCCTGACCGAGACCTGG in codon -7, causes a frameshift and premature stop at codon 68 HLA (2022) 100:384-385
C*07:1005N Point Exon 2, 271-273TAC>TAG, causes X67, a premature stop at codon 67
C*07:1037N Point Exon 2, 280-282CAT>TAG, causes Q70X, a premature stop in codon 70
C*07:1039N Insertion Exon 3, 606insG in codon 179, causes a frameshift and premature stop at codon 196
C*07:1040N Point Exon 3, 373-375TGC>TGA, causes C101X, a premature stop in codon 101
C*07:1042N Insertion Exon 3, 584insA in codon 171, causes frameshift and premature stop at codon 171
C*08:26N Point Exon 3, 439-441TAC>TAG, causes Y123X, a premature stop codon at 123 Tissue Antigens (2011) 77:54-61
C*08:36N Point Exon 3, 439-441TAC>TAG, causes Y123X, a premature stop at codon 123 HLA (2017) 90:171-173
C*08:52N Deletion Exon 4, 678delG, in codon 202, causes frameshift and premature stop at codon 215
C*08:55N Point Exon 2, 175-178CGG>TAG, causes R35X, a premature stop at codon 35
C*08:88N Deletion Exon 3, 421-427delGCCTACG, in codon 117-119, causes a frame shift and premature stop at codon 124
C*08:89N Insertion Exon 2, 133>134InsC, in codon 21, causes a frame shift and premature stop at codon 74
C*08:121N Deletion Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop at codon 73 HLA (2016) 87:55-56
C*08:127N Insertion Exon 3, 434-435insG, in codon 121, causes frameshift and premature stop at codon 128
C*08:129N Insertion Exon 3, 437-438insA, in codon 121, causes frameshift and premature stop at codon 128
C*08:130N Point Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46
C*08:161N Insertion Exon 2, 155-186insGGAGAGCCCCGCTTCATCGCAGTGGGCTACG, in codon 28, causes frameshift and premature stop at codon 84
C*08:173N Point Exon 2, 250-252TGG>TGA, causes X60, a premature stop in codon 60
C*08:180N Deletion Exon 2, 352-353delAC, in codon 94, causes a frameshift and premature stop at codon 113
C*08:181N Deletion Exon 2, 327delC in codon 85, causes frameshift and premature stop at codon 85
C*08:208N Point Exon 3, 424-426, TAC>TAG, causes X118, a premature stop at codon 118.
C*08:214N Point Exon 2, 250-253TGG>TAA, causes W60X, a premature stop in codon 60
C*08:224N Insertion Exon 3, 507insC in codon 146, causes frameshift and premature stop at codon 152
C*08:236N Point Exon 5, 907-909CAG>TAG, causes X279, a premature stop at codon 279
C*12:39N Point Exon 2, 250-252TGG>TGA, causes W60X, a premature stop at codon 60 Tissue Antigens (2014) 83:184-189
C*12:46N Point Exon 3, 424-429TAC>TAG, causes Y118X, a premature stop at codon 118 Tissue Antigens (2014) 83:184-189
C*12:80N Point Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60
C*12:84N Insertion Exon 2, 202-204insA, in codon 44, causes frame shift and premature stop at codon 74
C*12:104N Point Exon 3, 502-504CAG-TAG, causes Q144X, a premature stop at codon 144
C*12:105N Point Exon 3, 514-516GAG>TAG, causes E148X, a premature stop at codon 148 HLA (2017) 90:171-173
C*12:148N Point Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65
C*12:219N Point Exon 3, 508A>T, causes K146X, a premature stop at codon 146
C*12:232N Deletion Exon 3, 564-567delCGTG, in codons 164-165, causes frameshift and premature stop in codon 188
C*12:236N Deletion Exon 3, 573delG in codon167, causes frameshift and premature stop in codon 189
C*12:270N Deletion Exon 3, 352-353delAC, in codon 94, causes a frameshift and premature stop at codon 113
C*12:274:01N Deletion Exon 2, 208delG, in codon 46, causes a frameshift and premature stop at codon 76.
C*12:295N Deletion Exon 4, 746-758delCTCAGGACACCGA, in codons 225-229, causes frameshift and premature stop at codon 268
C*12:311N Deletion Exon 2, 267-268delGA, causes frameshift and premature stop at codon 73
C*12:324N Deletion Exon 4, 875delA, in codon 268, causes a frameshift and premature stop in codon 268
C*12:327N Point Exon 3, 619621GAA>TAA, causes E183X, a premature stop in codon 183
C*12:329N Deletion Exon 2, 208delG, in codon 46, causes a frameshift and premature stop at codon 76.
C*12:343N Deletion Exon 3, 537delG in codon 155, causes frameshift and premature stop at codon 189
C*12:345N Point Exon 2, 469-471TGG>TAG, causes X133, a premature stop at codon 133
C*14:07N Point Exon 3, 583-585TAC-TAA, causes Y171X, a premature stop at codon 171
C*14:21N Point Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 HLA (2017) 90:171-173
C*14:35N Point Exon 3 361-363TGG>TGA, causes W97X, a premature stop at codon 97
C*14:47:01N Point Exon 3, 469-471TGG>TGA, causes W133X, a premature stop at codon 133
C*14:47:02N Point Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133
C*14:93N Point Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop in codon 144 HLA (2018) 92:107-108
HLA (2018) 92:107-108
C*14:97N Point Exon 2, 250-252TGG>TGA, causes X60, a premature stop in codon 60
C*14:99N Insertion Exon 4, 246-249insCGGA, in codon 58, causes frameshift and premature stop in codon 76
C*14:117N Point Exon 4, 889-891, AGA>TGA, causes X273, a premature stop at codon 273
C*14:141N Deletion Exon 2, 244delG in codon 58, causes frameshift and premature stop at codon 76
C*14:148N Deletion Exon 3, 381delG in codon 103, cause a frameshift and premature stop at codon 126
C*15:02:01:08N Point Intron 2, g431A>T, causes incorrect splicing and the deletion of 17bp, resulting in a frameshift and premature stop codon HLA (2018) 91:187-194
C*15:92N Point Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop codon at 96
C*15:95N Point Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon in 65 HLA (2016) 87:31-35
C*15:115N Point Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54
C*15:122N Point Exon 2, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 HLA (2018) 92:304-309
C*15:145N Point Exon 3, 589G>T, causes E173X, premature stop at codon 173
C*15:156N Deletion Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop in codon 73
C*15:160N Point Exon 2, 802-804TGG>TGA, causes X244, a premature stop in codon 244 HLA (2020) 96:227-229
C*15:164N Point Exon 4, 682-684TGG>TGA, causes X204, a premature stop in codon 204
C*15:177N Deletion Exon 3, 426delC, in codon 118, causes a frameshift and premature stop at codon 118.
C*15:185N Deletion Exon 3, 590-596delAGAACGG, in codons 173-175, causes frameshift and premature stop in codon 187
C*15:188N Deletion Exon 2, 261delG, in codon 63, causes a frameshift and premature stop at codon 76
C*15:189N Insertion Exon 2, 240-253insGCCGGAGTATTGGG, in codon 61, causes a frameshift and premature stop at codon 81
C*15:213N Deletion Exon 4, 736delG, in codon 222, causes frameshift and premature stop at codon 272
C*15:216N Point Exon 2, 244-246GAG>TAG, causes E58X, a premature stop in codon 58.
C*15:238N Insertion Exon 3, 384insG, in codon 105, causes a frameshift and premature stop in codon 114
C*15:247N Deletion Exon 3, 415delC, in codon 115, causes a frameshift and premature stop in codon 116
C*16:30N Point Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87 Tissue Antigens (2014) 83:184-189
C*16:77N Point Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 HLA (2017) 90:79-87
C*16:89N Point Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58
C*16:123N Point Exon 2, 271-273TAC>TAG, causes X67, a premature stop in codon 67 HLA (2019) 93:505-506
C*16:132N Point Exon 3, 361-363TGG>TGA, causes X97, a premature stop in codon 97
C*16:186N Insertion Exon 4, 842insGATA, in codon 257, causes a frameshift and premature stop in codon 257
C*16:195N Insertion Exon 3, 618insCG, causes a frameshift and premature stop in codon 190
C*17:27N Point Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 HLA (2016) 87:31-35
C*18:07N Point Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115
E*01:08:01N Point Exon 2, 313-315TAC>TAG, causes Y84X, a premature stop at codon 84 HLA (2017) 89:143-149
E*01:08:02N Point Exon 2, 313-315TAC>TAG, causes Y84X, a premature stop at codon 84 HLA (2021) 97:389-398
E*01:21:01N Point Exon 3, 349-351CAG>TAG, causes X96, a premature stop at codon 96 HLA (2021) 97:389-398
E*01:25N Point Exon 1, 316-318TAC>TAG, causes X85, a premature stop at codon 85 HLA (2021) 97:389-398
E*01:55N Point Exon 3, 364-366, TGC>TGA, causes X101, a premature stop at codon 101 HLA (2021) 97:389-398
E*01:91N Point Exon 3, 400-402, TAT>TAA causes X113, a premature stop at codon 113 HLA (2021) 97:389-398
E*01:117N Point Exon 3, 349-351CAG>TAG, causes X96, a premature stop at codon 96 HLA (2021) 97:389-398
E*01:126N Deletion Exon 3, 373-378delGGGCC in codon 104-105, causes a frameshift and premature stop at codon 112
E*01:139N Point Exon 2, 241-243TGG>TGA, causes W60X, a premature stop in codon 60
E*01:141N Point Exon 2, 142-144TAC>TAG, causes Y27X, a premature stop in codon 27
G*01:05:01N Deletion Exon 3, 460delC, in codon 130, causes frameshift and premature stop at codon 189 Immunogenetics (1997) 45:464-465
Immunogenetics (2006) 58:241-251
G*01:05:02N Deletion Exon 3, 460delC, in codon 130, causes frameshift and premature stop at codon 189
G*01:13N Point Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 Tissue Antigens (2008) 72:491-505
G*01:21N Point Exon 3, 748C>T, causes Q226X, premature stop at codon 226 HLA (2018) 91:146-147
G*01:25N Deletion Exon 3, 443-4delTC in codon 124, causes frameshift and premature stop at codon 147.
G*01:28N Point Exon 3 409-411TAT>TAA, causes Y113X, a premature stop in codon 113
DRB1*01:33N Deletion Exon 2, 123delG, causes frameshift and premature stop codon at 50 Tissue Antigens (2011) 78:463-464
DRB1*01:39N Point Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9 Tissue Antigens (2014) 84:497-502
DRB1*01:40N Point Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9
DRB1*01:52N Point Exon 2, 336-338TAC>TAG, causes Y83X, a premature stop at codon 83
DRB1*01:62:01N Point Exon 2, 268-270TGG>TGA, causes W61X, a premature stop at codon 61
DRB1*01:62:02N Point Exon 2, 268-270TGG>TAG, causes W61X, a premature stop at codon 61
DRB1*01:68N Point Exon 2, 295-297CAG>TAG, causes Q70X, a premature stop at codon 70
DRB1*01:131N Deletion Exon 2, 121-126delAAGTT, causes a frameshift and premature stop in codon 12
DRB1*03:67N Point Exon 2, 268-270TGG>TGA, causes W61X, a premature stop at codon 61 Tissue Antigens (2014) 84:497-502
DRB1*03:68N Point Exon 2, 367-369CGA>TGA, causes R94X, a premature stop at codon 94
DRB1*03:156N Deletion Exon 2, 258-273delTGCCGAGTACTGGAAC, in codons 57-62, causes a premature stop at codon 94
DRB1*03:174N Insertion Exon 2, 308insC, in codon 74, causes a frameshift and premature stop in codon 98
DRB1*03:189N Point Exon 2, 262-264GAG>TAG, causes E59X, a premature stop in codon 59
DRB1*04:81N Deletion Exon 2, 296-297delAG, in codon 70, causes frameshift and premature stop at codon 86
DRB1*04:94:01N Point Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78 Tissue Antigens (2011) 78:226-227
DRB1*04:119N Point Exon 2, 334-336TAC>TAG, causes Y83X, a premature stop at codon 83 Tissue Antigens (2014) 84:497-502
DRB1*04:120N Point Exon 2, 319-332TAC>TAA, causes Y78X, a premature stop at codon 78 Tissue Antigens (2014) 84:497-502
DRB1*04:142N Point Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83 Tissue Antigens (2014) 84:497-502
DRB1*04:157N Point Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78
DRB1*04:158N Insertion Exon 2, 304-305insG, in codon 73, causes a frame shift and premature stop codon at codon 87
DRB1*04:178N Insertion Exon 2, 318-319insC, in codon 87, causes frame shift and premature stop at codon at 87 Tissue Antigens (2015) 85:78-79
DRB1*04:186N Point Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78
DRB1*04:212N Point Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78
DRB1*04:214N Point Exon 2, 187-189CAA>TAA, causes Q34X, a premature stop at codon 34
DRB1*04:247N Point Exon 2, 268-270TGG>TGA, causes X61, a premature stop in codon 61
DRB1*04:264N Point Exon 2, 169-171GAC>TAA, causes X28, a premature stop in codon 28
DRB1*04:266N Deletion Exon 3, 498delA, in codon 137, causes a frameshift and premature stop at codon 147
DRB1*04:267N Insertion Exon 2, 305insG, in codon 73, causes a frameshift and premature stop at codon 98
DRB1*04:280N Point Exon 2, 181-183TAT>TAA, causes Y32X, a premature stop in codon 35
DRB1*04:286N Point Exon 3, 406-408CAG>TAG, causes Q107X, a premature stop in codon 107
DRB1*04:299N Insertion Exon 2, 288insC, in codon 68, causes frameshift and premature stop at codon 98
DRB1*04:300N Deletion Exon 3, 489delC, in codon 134, causes frameshift and premature stop at codon 147
DRB1*04:312N Point Exon 2, 127-129GAG>TAG, causes E14X, a premature stop in codon 14
DRB1*04:329N Point Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop in codon 64
DRB1*07:10N Deletion Exon 2, 175-176delTG, in codon 30, causes frameshift and premature stop at codon 32 Immunogenetics (2007) 59:507-510
DRB1*07:26N Insertion Exon 2, 172-173insA, in codon 29, causes a frame shift and a premature stop at codon 33
DRB1*07:58N Point Exon 2, 160-162CAG>TAG, causes R25X, a premature stop at codon 25
DRB1*07:68N Deletion Exon 2, 278delA, in codon 64, causes frameshift and premature stop at codon 99
DRB1*07:87N Point Exon 2, 367-369CGA>TGA, causes X94, a premature stop in codon 94
DRB1*07:101N Deletion Exon 3, 262delC in codon 59, causes frameshift and premature stop at codon 99
DRB1*07:118N Point Exon 2, 115-117, CAG>TAG, causes X10, a premature stop at codon 10
DRB1*07:129N Point Exon 2, 187CAG>TAG, causes Q34X, a premature stop in codon 34 HLA (2022) 99:133-134
DRB1*08:60N Deletion Exon 2, 341delT, in codon 85, causes frameshift and premature stop at codon 99
DRB1*08:78N Point Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop at codon 64
DRB1*08:89N Deletion Exon 2, 157delG, in codon 24, causes a frameshift and premature stop at codon 50
DRB1*09:37N Deletion Exon 2, 128-131delAGTG, in codons 14-15, causes a frameshift and premature stop at codon 50
DRB1*09:52N Deletion Exon 2, 285delC in codon 66, causes a frameshift and premature stop at codon 99
DRB1*11:169N Deletion Exon 2, 326-327delGA, in codon 80, causes frameshift and premature stop at codon 86
DRB1*11:217N Point Exon 2, 194G>T, causes E36X, premature stop at codon 36
DRB1*11:246N Insertion Exon 2, 175insA, in codon 30, causes a frameshift and a premature stop at codon 33.
DRB1*11:250N Insertion Exon 3, 585-607insGAGTGGAGAGGTTTACACCTGCC, in codon 174, causes a frameshift and premature stop at codon 188
DRB1*11:287N Point Exon 2, 268-270TGG>TGA, causes X61, a premature stop at codon 61
DRB1*11:294N Deletion Exon 2, 256delGATG in codon 57, causes a frameshift and premature stop in codon 98
DRB1*11:301N Insertion Exon 3, 631insA in codon 182, causes a frameshift and premature stop at codon 193
DRB1*11:303N Deletion Exon 3, 524delG in codon 146, causes a frameshift and premature stop at codon 147
DRB1*12:24N Point Exon 2, 268-270TGG>TAG, causes Y61X, a premature stop at codon 61 Tissue Antigens (2011) 78:45-48
DRB1*12:31N Point Exon 2, 127-129GAA>TAG, causes E14X, a premature stop at codon 14 HLA (2017) 90:171-173
DRB1*12:60N Deletion Exon 2, 157-157delG, in codon 24, causes frameshift and premature stop at codon 50 HLA (2017) 89:65-66
DRB1*12:72N Deletion Exon 3, 409-424delCCCCTGCAGCACCACA, in codons 108-113, causes a frameshift and premature stop at codon 114
DRB1*12:74N Deletion Exon 2, 254delC, in codon 56, causes a frameshift and premature stop at codon 99
DRB1*12:86N Point Exon 3, 415-417CAG>TAG, causes X110, a premature stop at codon 110
DRB1*12:98N Insertion Exon 2, 223insG in codon 46, causes a frameshift and premature stop at codon 97
DRB1*13:113N Deletion Exon 2, 246delG, causes frameshift and premature stop at codon 99 HLA (2017) 90:171-173
DRB1*13:137N Point Exon 2, 298-300AGG>TAG, causes R71X, a premature stop at codon 71 Tissue Antigens (2014) 84:497-502
DRB1*13:142N Point Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop at codon 64 Tissue Antigens (2014) 84:497-502
DRB1*13:185N Point Exon 2, 223-225GAG>TAG, causes E46X, a premature stop at codon 46
DRB1*13:200N Point Exon 2, 112-114GAG>TAG, causes W9X, a premature stop at codon 9
DRB1*13:249N Deletion Exon 2, 270delG, in codon 61, causes frameshift and premature stop at codon 61
DRB1*13:252N Point Exon 2, 367-369CGA>TGA, causes X94, a premature stop in codon 94
DRB1*13:255N Point Exon 3, 478-480TGG>TAG, causes X131, a premature stop in codon 131
DRB1*13:268N Deletion Exon 3, 610delG, in codon 175, causes a frameshift and premature stop at codon 180
DRB1*13:289N Insertion Exon 2, 269insTACT, in codon 61, causes a frameshift and premature stop in codon 88.
DRB1*13:295N Insertion Exon 2, 304insG in codon 73, causes frameshift and premature stop at codon 87
DRB1*13:298N Deletion Exon 3, 415-416delCA, in codon 110, causes frameshift and premature stop at codon 127 HLA (2022) 99:659-660
DRB1*13:310N Point Exon 2, 367-369CGA>TGA, casuses X94, a premature stop at codon 94
DRB1*13:319N Deletion Exon 3, 501delAA, in codon 139, causes a frameshift and premature stop at codon 192
DRB1*13:322N Deletion Exon 3, 421delC, in codon 112, causes a frameshift and premature stop in codon 119 HLA (2022) 100:165-166
DRB1*13:324N Point Exon 3, 607-609CAA>TAA, causes Q174X, a premature stop in codon 174
DRB1*13:329N Deletion Exon 3, 563delTG in codon 159, causes a frameshift and premature stop at codon 192
DRB1*14:92N Point Exon 2, 190-192GAG>TAG, causes E35X, a premature stop at codon 35
DRB1*14:137N Insertion Exon 2, 304-305insG, in codon 73, causes frame shift and premature stop at codon 98 Tissue Antigens (2013) 82:201-202
DRB1*14:152N Insertion Exon 2, 303-304insG, in codon 73, causes a frame shift and a premature stop at codon 98
DRB1*14:166N Point Exon 2, 173-174insA, in codon 29, causes frameshift and premature stop at codon 33 HLA (2016) 87:60-
DRB1*14:188N Point Exon 2, 113C>T, causes Q16X, premature stop at codon 116
DRB1*14:195N Point Exon 2, 265-267TAC>TAG, causes X60, a premature stop in codon 60
DRB1*14:197N Point Exon 2, 307-309GAG>TAG, causes X74, a premature stop in codon 74
DRB1*14:222N Point Exon 2, 262-264, GAG>TAG, causes E59X, a premature stop in codon 59. HLA (2021) 98:562-564
DRB1*14:231N Deletion Exon 2, 118-123delTCTAC in codon 11-12, causes frameshift and premature stop at codon 12
DRB1*15:17N Insertion Exon 2, 294-295insGA, in codon70, causes frameshift and premature stop at codon 100 Tissue Antigens (2005) 66:334-335
DRB1*15:50N Deletion Exon 2, 303-304delGG, causes frameshift and premature stop at codon 97
DRB1*15:80N Deletion Exon 2, 303-304delGG, in codon 71, causes frameshift and premature stop at codon 86
DRB1*15:113N Point Exon 2, 115-117CAG>TAG, causes Q10X, a premature stop at codon 10
DRB1*15:115N Deletion Exon 2, 295-296delGA, in codon 70, causes frameshift and premature stop at codon 86 Tissue Antigens (2015) 86:69-70
DRB1*15:129N Deletion Exon 2, 303-304delGG, in codons 72-73, causes frameshift and premature stop at codon 97
DRB1*15:134N Deletion Exon 2, 142-143delTG, in codon 19, causes frameshift and premature stop at codon 32
DRB1*15:137N Point Exon 2, 187-189CAG>TAG, causes Q34X, a premature stop at codon 34
DRB1*15:138N Insertion Exon 2, 158-158insG, in codon 24, causes frameshift and premature stop at codon 33
DRB1*15:148N Deletion Exon 2, 187delC in codon 34, causes frameshift and premature stop in codon 50 HLA (2018) 91:544-545
DRB1*15:154N Point Exon 3, 615-617GAG>TAG, causes X176, a premature stop in codon 176
DRB1*15:159N Point Exon 2, 367-369CGA>TGA, causes X94, a premature stop in codon 94
DRB1*15:163N Deletion Exon 3, 406delC, in codon 107, causes a frameshift and premature stop in codon 119
DRB1*15:176N Insertion Exon 2, 259insGC, in codon 58, causes a frameshift and premature stop in codon 100 HLA (2019) 94:462-463
DRB1*15:180N Point Exon 3, 373-375, CAA>TAA, causes X96, a premature stop at codon 96
DRB1*15:183N Deletion Exon 2, 224delA in codon 46, causes frameshift and premature stop at codon 50
DRB1*15:200:01:01N Insertion Exon 2, 190insG, in codon 35, causes a frameshift and premature stop in codon 57
DRB1*15:200:01:02N Insertion Exon 2, 190insG in codon 35, causes a frameshift and premature stop at codon 57
DRB1*15:207N Deletion Exon 2, 164-170delTCCTGGA in codon 26, causes frameshift and premature stop at codon 48
DRB1*15:209N Deletion Exon 2, 270delG in codon 61, Causes X61, a frameshift and premature stop at codon 61
DRB1*16:13N Point Exon 2, 241-243GAG>TAG, causes E52X, a premature stop at codon 52 Tissue Antigens (2008) 71:180-182
DRB1*16:21N Deletion Exon 2, 170-171delAA, in codon 28, causes frameshift and premature stop at codon 32
DRB1*16:41N Point Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83
DRB1*16:55N Insertion Exon 2, 303-304insGG, in codon 73, causes a frameshift and premature stop in codon 100
DRB1*16:62N Insertion Exon 2, 134insA, in codon 16, causes frameshift and premature stop at codon 33
DRB1*16:63N Deletion Exon 2, 216delC, in codon 43, causes a frameshift and premature stop at codon 50
DRB1*16:70N Insertion Exon 2, 305insGG, in codon 73, causes a frameshift and premature stop at codon 100
DRB3*01:26N Point Exon 2, 175-177TAC>TAA, causes C30X, a premature stop at codon 30
DRB3*01:40:01N Point Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83
DRB3*01:40:02N Point Exon 2, 334-336TAC>TAG, causes X83, a premature stop in codon 83
DRB3*01:73N Insertion Exon 2, 224insG in codon 46, causes frameshift and premature stop at codon 87
DRB3*01:77N Point Exon 2, 367-369CGA>TGA, causes R94X, a premature stop at codon 94.
DRB3*01:81N Deletion Exon 2, 207delC, in codon 40, causes frameshift and premature stop at codon 50
DRB3*01:97N Deletion Exon 2, 222delG, in codon 46, causes a frameshift and premature stop in codon 50. Human Immunology (2021) 82:982-984
DRB3*01:105N Deletion Exon 2, 339-340delGG, in codon 84, causes a frameshift and premature stop at codon86
DRB3*02:29N Deletion Exon 3, 588-592delTGGAG, in codons 167-169, causes frameshift and premature stop at codon 191
DRB3*02:55N Point Exon 2, 334-336TAC>TAG, causes Y83X, a premature stop at codon 83
DRB3*02:67N Point Exon 2, 277C>T, causes Q64X, a premature stop at codon 64
DRB3*02:80:01N Point Exon 2, 268-270TGG>TGA, causes X61, a premature stop in codon 61
DRB3*02:80:02N Point Exon 2, 269-271TGA>TAG, causes X61, a premature stop at codon 61
DRB3*02:95N Deletion Exon 2, 225delG, in codon 46, causes a frameshift and premature stop in codon 50
DRB3*02:109N Point Exon 2, 307-307CAG>TAG, causes Q34X, a premature stop in codon 74
DRB3*02:121N Insertion Exon 2, 260-263insCCGA, in codon 59, causes frameshift and premature stop at codon 88
DRB3*02:125N Insertion Exon 2, 258insT, in codon 58, causes frameshift and premature stop at codon 87
DRB3*02:137N Insertion Exon 2, 304insG, in codon 73, causes frameshift and premature stop at codon 87
DRB3*02:145N Point Exon 3, 607-609CAA>TAA, causes Q174X, a premature stop at codon 174
DRB3*02:165N Point Exon 3, 478-480TGG>TGA, causes X131, a premature stop at codon 131
DRB3*02:179N Point Exon 3, 379-381CAG>TAG, causes Q98X, a premature stop in codon 98
DRB3*03:30N Deletion Exon 2, 231delG in codon 46, causes X50, frameshift and premature stop at codon 50
DRB4*01:03:01:02N Point Intron 1, 9656G>A, causes a mutation in the splice site preceeding exon 2, causing incorrect splicing and the deletion of 17bp, resulting in a frameshift and premature stop codon Immunogenetics (1990) 31:112-117
Immunogenetics (1990) 31:112-117
Tissue Antigens (1997) 49:152-159
HLA (2022) 99:328-356
HLA (2022) 99:328-356
HLA (2022) 99:328-356
DRB4*01:03:01:13N Point Intron 1, g9656G>A, causes a mutation in the splice site preceeding exon 2, causing incorrect splicing and the deletion of 17bp, resulting in a frameshift and premature stop codon
DRB4*01:14N Point Intron 1, g9656G>A, causes incorrect splicing and the deletion of 17bp, resulting in a frameshift and premature stop codon HLA (2020) 95:73-75
DRB4*01:16N Point Exon 2, 265-267TAC>TAG, causes Y60X, a premature stop at codon 60
DRB4*01:38N Point Exon 2, 361-363CAG>TAG causes Q92X, a premature stop at codon 92
DRB4*01:54:01N Point Exon 2, 367C>T, causes R94X, premature stop at codon 94
DRB4*01:54:02N Point Exon 2, 367369CGA>TGA, causes R94X, a premature stop in codon 94
DRB4*01:56N Point Exon 2, 277C>T, causes Q64X, premature stop at codon 64
DRB4*01:57N Point Exon 2, 183T>G, causes Y32X, a premature stop at codon 32
DRB4*01:61N Point Exon 2, 330C>G, causes Y80X, a premature stop at codon 80
DRB4*01:65N Point Exon 2, 154-156CGA>TGA, causes R23X, a premature stop in codon 23
DRB4*01:71N Point Exon 2, 334-336TAC>TAG, causes X83, a premature stop in codon 83
DRB4*01:80N Insertion Exon 2, 291insT, in codon 68, causes a frameshift and premature stop in codon 98
DRB4*01:84N Deletion Exon 2, 267delC, in codon 60, causes a frameshift and premature stop in codon 99
DRB4*01:108N Deletion Exon 2, 212delG, in codon 42, causes frameshift and premature stop at codon 50
DRB4*01:113N Deletion Exon 2, 139delC, in codon 18, causes frameshift and premature stop at codon 27
DRB4*01:115N Deletion Exon 1, 125-128delTTGA, in codons 13-14, causes frameshift and premature stop at codon 26
DRB4*01:121N Point Exon 1, 115-117, CAG>TAG, causes X10, a premature stop at codon 10
DRB4*01:128N Point Exon 3, 391-393TAT>TAA, causes Y102X, a premature stop in codon 102
DRB4*01:145N Deletion Exon 3, 395delC in codon 103, causes frameshift and premature stop at codon 119
DRB4*01:149N Point Exon 2, 229-231CAG>TAG, causes R48X, a premature stop in codon 48.
DRB4*01:159N Deletion Exon 2, 356delCAGTGCAGCGGCGA in codon 90-94, causes a framshift and premature stop at codon 93.
DRB4*01:162N Point Exon 3, 478-480TGG>TAG, causes W131X, a premature stop in codon 131
DRB4*02:01N Deletion Exon 2, 155-165delGGGTGCGGTTG, in codons 23-26, causes frameshift and premature stop at codon 29 Immunogenetics (1997) 46:104-110
DRB4*03:01N Deletion The allele contains sequence for intron 2 and exon 3, but has no preceding exon sequences Immunogenetics (1997) 46:104-110
Human Immunology (2018) 79:491-493
DRB5*01:08:01N Deletion Exon 3, 572-590delAAACAGTTCCTCGGAGTGG, in codons 162-168, causes frameshift and possible stop codon after 171 Tissue Antigens (1997) 50:326-333
Human Immunology (2019) 80:437-448
HLA (2022) 99:328-356
DRB5*01:08:02N Deletion Exon 3, 573-591delAACAGTTCCTCGGAGTGGA in codons 162-168, causes frameshift and premature stop at codon 174
DRB5*01:10N Deletion Exon 2, 326- 327delGA, in codon 80, causes frameshift and premature stop at codon 86 Tissue Antigens (2000) 55:467-469
DRB5*01:27N Point Exon 2, 336C>G, causes Y83X, a premature stop at codon 83
DRB5*01:48N Point Exon 2, 265-267TAC>TAG, causes X60, a premature stop at codon 60
DRB5*01:49N Point Exon 3, 553-555CAG>TAG, causes X156, a premature stop at codon 156.
DRB5*01:52N Deletion Exon 2, 189-190delAG, in codons 34-35, causes a frameshift and premature stop at codon 56
DRB5*01:53N Insertion Exon 2, 247-248insTG, in codon 54, causes a frameshift and premature stop at codon 100
DRB5*01:58N Insertion Exon 2, 303-304insGG, in codon 72, causes a frameshift and premature stop in codon 100
DRB5*01:67N Insertion Exon 2, 288insT in codon 67, causes frameshift and premature stop at codon 8
DRB5*01:68N Point Exon 2, 124-126TAT>TAA, causes Y13X, a premature stop at codon 13
DRB5*01:71N Insertion Exon 2, 290insG, in codon 68, causes frameshift and premature stop at codon 87
DRB5*01:81N Insertion Exon 2, 318insC, in codon 78, causes a frameshift and premature stop at codon 87
DRB5*01:83N Insertion Exon 2, 224insA, in codon 46, causes frameshift and premature stop at codon 57
DRB5*01:92N Point Exon 2, 321-323TAC>TAG, causes Y78X, a premature stop in codon 78
DRB5*01:101N Insertion Exon 2, 108insT in codon 7, causes frameshift and premature stop at codon 12
DRB5*01:120N Deletion Exon 2, 298-299delAG in codon 70, causes a frameshift and premature stop at codon 86
DRB5*01:121N Deletion Exon 2, 303delGG in codon 72, causes a frameshift and premature stop at codon 86
DRB5*01:125N Deletion Exon 2, 296delGA in codon 70, causes a frameshift and premature stop at codon 86
DRB5*01:127N Deletion Exon 2, 573delAACAGTTCCTCGGAGTGGA in codons 162-168, causes a frameshift and premature stop at codon174
DRB5*02:19N Point Exon 2, 319-321TAC>TAA, causes X78, a premature stop in codon 78
DRB5*02:25N Deletion Exon 2, 303-304delGG, in codons 72-73, causes frameshift and premature stop in codon 95
DRB5*02:26N Deletion Exon 3, 573-591delAACAGTTCCTCGGAGTGGA, in codons 162-168, causes frameshift and premature stop in codon 174
DQA1*01:15N Point Exon 2, 212G>A, causes W48X, a premature stop at codon 48 HLA (2017) 90:130-131
DQA1*01:16N Deletion Exon 2, 236delG, in codon 56, causes frameshift and premature stop at codon 63
DQA1*01:88N Point Exon 2, 247-249CAG>TAG, causes X60, a premature stop at codon 60
DQA1*02:02N Insertion Exon 2, 329-330insGA, in codon 87, causes frameshift and premature stop in codon 100
DQA1*03:27N Deletion Exon 2, 179-193delTGGACCTGGAGAGG in codons 37-41, causes a frameshift and premature stop at codon 50
DQA1*03:32N Point Exon 2, 206-208TGG>TGA, causes X46, a premature stop at codon 46
DQA1*03:34N Point Exon 2, 208-210CAG>TAG, causes X47, a premature stop at codon 47
DQA1*04:03N Point Exon 2, 236-238AAA>TAA, causes Q53X, a premature stop at codon 53 Tissue Antigens (2004) 63:609-611
DQA1*04:12N Point Exon 2, 115-117TAC>TAG, causes X16, a premature stop at codon 16
DQA1*04:14N Deletion Exon 3, 408 delC in codon 113, causes a frameshift and premature stop at codon 125
DQA1*05:15N Deletion Exon 2, 203-206delTCTG, in codons 45-46, causes a frameshift and premature stop in codon 61
DQA1*05:17N Point Exon 3, 580-521TGG>TGA, causes W171X, a premature stop at codon 171
DQA1*05:36N Point Exon 2, 166-169GAG>TAG, in codon 33 causes E33X, a premature stop in codon 33
DQB1*05:41N Point Exon 3, 448-450TCG>TAG, causes S118X, a premature stop at codon 118 HLA (2017) 90:171-173
DQB1*05:90N Point Exon 3, 448-450TCG>TAG, causes S118X, a premature stop at codon 118
DQB1*05:110N Point Exon 2, 196-198CGA>TGA, causes R34X, a premature stop at codon 34
DQB1*05:128N Point Exon 2, 370-372CAG>TAG causes Q92X, a premature stop at codon 92
DQB1*05:185N Point Exon 2, 472-474CAG>TAG, causes X126, a premature stop at codon 126
DQB1*05:206N Deletion Exon 2, 279delG, in codon 61, causes a frameshift and premature stop in codon 61
DQB1*05:208N Point Exon 2, 124-126CAG>TAG, causes Q10X, a premature stop in codon 10
DQB1*05:215N Deletion Exon 2, 307delG, in codon 71, causes a frameshift and premature stop in codon 99
DQB1*05:224N Insertion Exon 2, 205insT, in codon 37, causes a frameshift and premature stop in codon 57
DQB1*05:235N Point Exon 2, 121-123TAC>TAA, causes Y9X, a premature stop in codon 9 HLA (2021) 97:254-255
DQB1*05:236N Point Exon 2, 196-199CGA>TGA, causes R34X, a premature stop in codon 34 HLA (2020) 96:373-375
DQB1*05:265N Deletion Exon 3, 529delA in codon 145, causes frameshift and premature stop at codon 159
DQB1*05:273N Deletion Exon 2, 192delT, in codon 32, causes a frameshift and premature stop at codon 32
DQB1*05:283N Deletion Exon 4, 730delT in codon 212, causes a frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 3 amino acids
DQB1*05:295N Insertion Exon 2, 152insCACCA in codon 19, causes a frameshift and premature stop at codon 29
DQB1*06:26N Point Exon 2, 181-183AGA>TGA, causes R29X, a premature stop at codon 29
DQB1*06:54N Point Exon 2, 277-279TGG>TGA, causes W61X, a premature stop at codon 61 Tissue Antigens (2014) 84:497-502
DQB1*06:75N Point Exon 2, 274-276TAC>TAG, causes Y60X, a premature stop at codon 60 Tissue Antigens (2014) 84:497-502
DQB1*06:77N Point Exon 2, 253-255CAG>TAG, causes Q53X, a premature stop at codon 53
DQB1*06:102N Point Exon 3, 487-489TGG>TAG, causes W131X, a premature stop at codon 131 HLA (2017) 90:171-173
DQB1*06:112N Point Exon 2, 124-126CAG>TAG, causes Q10X, a premature stop at codon 10 HLA (2017) 90:171-173
DQB1*06:144N Point Exon 2, 205-207TAC>TAA, causes Y37X, a premature stop at codon 37
DQB1*06:158N Point Exon 2, 196-198CGA>TGA causes R34X, a premature stop at codon 34
DQB1*06:179N Point Exon 2, 196-198CGA>TGA, causes R34X, a premature stop at codon 34
DQB1*06:193N Point Exon 2, 277-279TGG>TAG, causes Y61X, a premature stop at codon 61
DQB1*06:216N Point Exon 2, 655G>T, causes E187X, a premature stop at codon 187
DQB1*06:252N Deletion Exon 2, 139delT, in codon 15, causes frameshift and premature stop in codon 27
DQB1*06:303N Deletion Exon 2, 265-271delGTTGCCG, in codon 57, causes frameshift and premature stop at codon 97
DQB1*06:304N Deletion Exon 3, 535delC, in codon 147, causes frameshift and premature stop at codon 159
DQB1*06:306N Insertion Exon 2, 313insG, in codon 73, causes framshift and premature stop at codon 135
DQB1*06:308N Deletion Exon 3, 593delC, in codon 166, causes frameshift and premature stop at codon 200
DQB1*06:317N Point Exon 4, 682C>T, causes X196, a premature stop at codon 196
DQB1*06:330N Deletion Exon 3, 555delG, in codon 153, causes frameshift and premature stop in codon 153
DQB1*06:341N Point Exon 2, 343-345TAC>TAG, causes Y83X, a premature stop in codon 83
DQB1*06:345N Point Exon 2, 196-198CGA>TGA, causes R34X, a premature stop at codon 34
DQB1*06:379N Deletion Exon 2, 129delT, in codon 11, causes a frameshift and premature stop in codon 27 HLA (2020) 96:709-713
DQB1*06:383N Deletion Exon 2, 167-171delTGCGT in codon 24-25, causes a frameshift and premature stop at codon 31
DQB1*06:394N Point Exon 3, 553-555TGG>TAA, causes X153, a premature stop at codon 153
DQB1*06:397N Point Exon 3, 657-659TGG>TAG, causes X188, a premature stop at codon 188
DQB1*06:414N Deletion Exon 3, 516delC, in codon 140, causes a frameshift and premature stop at codon 159
DQB1*06:422N Insertion Exon 1, 54insTGTC in codon -14, causes frameshift and premature stop at codon 1
DQB1*06:423N Point Exon 2, 370-372CAG>TAG, causes Q92X, a premature stop in codon 92 HLA (2022) 100:186-188
DQB1*06:447N Deletion Exon 2, 232delG in codon 46, causes X50, a premature stop at codon 50
DQB1*02:18N Point Exon 2, 277-279TGG>TGA, causes W61X, a premature stop at codon 61 Tissue Antigens (2014) 84:497-502
DQB1*02:20N Point Exon 2, 376-378CGA>TGA, causes R94X, a premature stop at codon 94 Tissue Antigens (2014) 84:497-502
DQB1*02:58N Point Exon 2, 199-201GAA>TAA, causes E35X, a premature stop at codon 35
DQB1*02:67N Point Exon 2, 142-144TAC>TAG, causes Y16X, a premature stop at codon 16
DQB1*02:96N Point Exon 3, 449C>A, causes S118X, premature stop at codon 118
DQB1*02:129N Deletion Exon 2, 126delG, in codon 10, causes a frameshift and premature stop at codon 27
DQB1*02:132N Deletion Exon 2, 247delA, in codon 51, causes a frameshift and premature stop at codon 99
DQB1*02:134N Deletion Exon 2, 320delT, in codon 75, causes a frameshift and premature stop at codon 99
DQB1*02:162N Point Exon 2, 274-276TAC>TAG, causes Y60X, a premature stop in codon 60 HLA (2021) 98:244-246
DQB1*02:163N Point Exon 1, 67-69, TCG>TAG, causes X-10, a premature stop at codon -10
DQB1*02:167N Insertion Exon 2, 184-187insAGCA, in codon 31, causes frameshift and premature stop at codon 34
DQB1*02:176N Insertion Exon 3, 535insC, in codon 147, causes a frameshift and premature stop in codon 149
DQB1*02:177N Point Exon 2, 367-369TTG>TAG, causes L91X, a premature stop in codon 91
DQB1*02:183N Deletion Exon 2, 279delG in codon 61, causes frameshift and premature stop at codon 61.
DQB1*02:194N Point Exon 2, 139>141TGC>TGA, causes C15X, a premature stop at codon 15
DQB1*02:204N Insertion Exon 2, 362insCGACCTTGCA in codon 92, causes a frameshift and premature stop at codon 152
DQB1*02:206N Deletion Exon 3, 535delC in codon 147, causes a frameshift and premature stop at codon 159
DQB1*03:01:01:21N Point Intron 3, g4627G>A, affecting splice site for exon 3, which is shown to cause lack of protein expression HLA (2022) 99:160-166
DQB1*03:66N Point Exon 2, 277-279TGG>TAG, causes W61X, a premature stop at codon 61 Tissue Antigens (2014) 84:497-502
DQB1*03:84N Point Exon 2, 622-624GAG>TAG, causes E176X, a premature stop at codon 176
DQB1*03:90N Deletion Exon 2, 240delG, in codon 48, causes a premature stop codon at 50 HLA (2017) 90:171-173
DQB1*03:95N Deletion Exon 2, 183delG, in codon 29, causes a premature stop codon at 50 HLA (2017) 90:171-173
DQB1*03:118N Point Exon 2, 205-207TAC>TAA, causes Y37X, a premature stop at codon 37
DQB1*03:213N Point Exon 2, 286-288CAG>TAG, causes Q64X, a premature stop at codon 64
DQB1*03:237N Point Exon 2, 205-207TAC>TAA causes Y37X, a premature stop at codon 37
DQB1*03:269N Point Exon 2, 196C>T, causes R34X, premature stop at codon 34 HLA (2019) 95:128-130
DQB1*03:276N Deletion The allele contains sequence from intron 1 onwards, but has no preceding exon sequences Human Immunology (2018) 79:491-493
DQB1*03:282N Deletion Exon 2, 258delG, in codon 54, causes frameshift and premature stop in codon 99 HLA (2021) 98:408-410
DQB1*03:303N Point Exon 2, 301-303GAG>TAG, causes X69, a premature stop at codon 69
DQB1*03:310N Deletion Exon 3, 525-531delGTCCACC, in codons 143-145, causes a frameshift and premature stop at codon 157
DQB1*03:334N Point Exon 2, 121-123TAC>TAG, causes X9, a premature stop at codon 9
DQB1*03:338N Deletion Exon 3, 535delC, in codon 147, causes a frameshift and premature stop at codon 159
DQB1*03:339N Insertion Exon 2, 233insG, in codon 46, causes a frameshift and premature stop at codon 135
DQB1*03:340N Deletion Exon 3, 566delT, in codon 157, causes a frameshift and premature stop at codon 159
DQB1*03:354N Deletion Exon 2, 209-221delCACGCTTCGACAG, in codons 38-42, causes a frameshift and premature stop in codon 46
DQB1*03:356N Insertion Exon 2, 222-226insGACAG, in codon 42, causes frameshift and premature stop in codon 52
DQB1*03:357N Deletion Exon 2, 220delA, in codon 42, causes a frameshift and premature stop in codon 50
DQB1*03:358N Deletion Exon 3, 634-661delCTCCAGAACCCCATCACCGTGGAGTGGC, in codons 180-189, causes a frameshift and premature stop in codon 191
DQB1*03:375N Point Exon 3, 4445-447TGC>TGA, causes C117X, a premature stop in codon 117
DQB1*03:376N Point Exon 3, 658-660TGG>TAG, causes W188X, a premature stop in codon 188
DQB1*03:385N Point Exon 3, 592-594CAG>TAG, causes Q166X, a premature stop in codon 166
DQB1*03:399N Point Exon 2, 346-348CAG>TAG, causes Q84X, a premature stop at codon 84
DQB1*03:400N Insertion Exon 3, 353insC, in codon 147, causes a frameshift and a premature stop in codon 149 HLA (2020) 96:749-750
DQB1*03:403N Insertion Exon 3, 583-589insTTTGTCT, in codon 165, causes frameshift and premature stop at codon 195
DQB1*03:407N Point Exon 2, 121-123, TAC>TAG, causes X9, a premature stop at codon 9
DQB1*03:411N Deletion Exon 2, 313delG in codon 73, causes frameshift and premature stop at codon 99
DQB1*03:422N Point Exon 3, 637-639, CAG>TAG, causes X181, a premature stop at codon 181 Human Immunology (2020) 81:202-205
DQB1*03:427N Insertion Exon 2, 236insGT, in codon 47, causes a frameshift and premature stop in codon 51.
DQB1*03:440N Insertion Exon 2, 327insT in codon 77, causes frameshift and premature stop at codon 135
DQB1*03:473N Point Exon 2, 292-294GAA>TAA, causes X66, a premature stop at codon 66
DQB1*03:488N Point Exon 2, 331-333TGC>TGA, causes X79, a premature stop at codon 79
DQB1*03:499N Point Exon 2, 172-174TAT>TAA, causes X26, a premature stop at codon 26
DQB1*04:25N Point Exon 2, 271-273GAG>TAG, causes E59X, a premature stop at codon 59 HLA (2016) 87:31-35
DQB1*04:36N Point Exon 2, 376-378CGA>TGA, causes R94X, a premature stop at codon 94
DQB1*04:41N Point Exon 3, 465T>G, causes Y123X, a premature stop at codon 123
DQB1*04:46N Point Exon 3, 472-474CAG>TAG, causes X126, a premature stop in codon 126
DQB1*04:59N Deletion Exon 3, 592delC, in codon 166, causes a frameshift and premature stop at codon 200
DQB1*04:68N Insertion Exon 3, 406insT, in codon 104, causes frameshift and premature stop in codon 135
DQB1*04:73N Deletion Exon 2, 247delA, in codon 51, causes a frameshift and premature stop in codon 99 HLA (2021) 97:171-172
DPA1*01:29N Point Exon 3, 454-456, TGG>TAG, causes X121, a premature stop at codon 121 HLA (2020) 95:82-83
DPA1*01:32N Point Exon 2, 154-156GAG>TAG, causes E21X, a premature stop in codon 21
DPA1*01:35N Point Exon 2, 316-318,CAG>TAG, causes X75, a premature stop at codon 75 HLA (2020) 96:378-379
DPA1*01:55N Deletion Exon 3, 586delG in codon 165, causes frameshift and premature stop at codon 203
DPA1*01:66N Deletion Exon 2, 302delT in codon 70, causes frameshift and premature stop at codon 70
DPA1*01:79N Insertion Exon 2, 326insA in codon 78, causes frameshift and premature stop at codon 88
DPA1*01:114N Point Exon 2, 241-243CAA>TAA, causes X50, a premature stop at codon 50
DPA1*01:119N Point Exon 2, 334-336 CAG>TAG, causes X81, a premature stop at codon 81
DPA1*01:120N Point Exon 262-264CAG>TAG, causes X57, a premature stop at codon 57
DPA1*01:123N Deletion Exon 2, 146-163delCAACAGGGGAGTTTATG in codon 18, causes a frameshift and premature stop at codon 19
DPA1*02:13N Point Exon 4, 628-630GAG>TAG, causes X179, a premature stop at codon 179
DPA1*02:32N Deletion Exon 3, 369delT in codon 92, causes frameshift and premature stop at codon 151. Human Immunology (2020) 81:202-205
DPA1*02:41N Point Exon 3, 628-670GAG>TAG, in codon 179, causes E179X, a premature stop in codon 179
DPA1*02:52N Point Exon 2, 220-222TGG>TGA, causes W43X, a premature stop in codon 43
DPA1*02:66:01N Point Exon 2, 241-243CGA>TGA, causes X50, a premature stop at codon 50
DPA1*02:66:02N Point Exon 2, 241-243 CGA>TGA, causes X50, a premature stop at codon 50
DPA1*02:74N Deletion Exon 2, 330delC, in codon 79, causing a frameshift and premature stop in codon 89
DPA1*02:80N Insertion Exon 2, 181insGC in codon 30, causes a frameshift and premature stop at codon 67
DPA1*02:94N Point Exon 2, 334-336CAG>TAG, causes X81, a premature stop at codon 81
DPA1*03:10N Point Exon 2, 175-177GAA>TAA, causes X28, a premature stop at codon 28
DPA1*03:11N Insertion Exon 4, 632insAGAGC, causes a frameshift and premature stop in codon 205
DPB1*04:01:01:24N Point Intron 2, g5163G>T, affecting splicing site for exon 2
DPB1*61:01N Point Exon 2, 286-288GAG>TAG, causes E67X, a premature stop at codon 67 Tissue Antigens (1996) 47:293-299
DPB1*64:01N Point Exon 2, 106-108TAC>TAA, causes Y7X, a premature stop at codon 7 Tissue Antigens (1997) 49:262-266
HLA (2018) 92:426-427
DPB1*120:01N Point Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10
DPB1*154:01N Point Exon 2, 271-273CAG>TAG, causes Q62X, a premature stop at codon 62
DPB1*159:01N Point Exon 2, 361-363CGA>TGA, causes R92X, a premature stop at codon 92
DPB1*161:01N Point Exon 2, 340-342GAG>TAG, causes E85X, a premature stop at codon 85
DPB1*216:01N Point Exon 2, 319-321AGA>TGA, causes R78X, a premature stop at codon 78 HLA (2016) 87:31-35
DPB1*218:01N Point Exon 2, 151-153CAG>TAG, causes Q22X, a premature stop at codon 22
DPB1*328:01N Point Exon 2, 361-363CGA>TGA, causes R92X, a premature stop at codon 92
DPB1*357:01N Point Exon 2, 328-330TAC>TAG, causes Y81X, a premature stop at codon 81 HLA (2016) 87:31-35
DPB1*382:01N Point Exon 2, 166-168AGA>TGA, causes R27X, a premature stop at codon 27
DPB1*401:01:01N Point Exon 2, 328-330TAC>TAG, causes Y81X, a premature stop at codon 81
DPB1*401:01:02N Point Exon 2, 328-330TAG>TAA, causes X81, a premature stop at codon 81.
DPB1*403:01N Point Exon 2, 262-264TGG>TGA, causes W59X, a premature stop at codon 59
DPB1*450:01N Point Exon 2, 124-126CAG>TAG, causes Q13X, a premature stop at codon 13
DPB1*455:01N Point Exon 2, 355-357CAG>TAG, causes Q90X, a premature stop at codon 90
DPB1*507:01N Point Exon 2, 340-342GAG>TAG, causes E85X, a premature stop at codon 85
DPB1*551:01N Point Exon 2, 262-264TGG>TGA, causes W59X, a premature stop at codon 59
DPB1*570:01N Point Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10
DPB1*598:01N Point Exon 2, 151-153CAG>TAG, causes Q22X, a premature stop at codon 22
DPB1*657:01N Point Exon 2, 330TAC>TAA, causes Y81X, a premature stop at codon 81
DPB1*661:01N Point Exon 2, 166C>A, causes R27X, a premature stop at codon 27
DPB1*691:01N Point Exon 2, 184G>T, causes E33X a premature stop at codon 33
DPB1*693:01N Deletion Exon 2, 184delG, in codon 33, causes frameshift and premature stop at codon 48
DPB1*696:01N Deletion Exon 2, 132-133delCT, in codons 14-15, causes frameshift and premature stop in codon 15
DPB1*700:01N Point Exon 3, 490-492GAG>TAG, causes E135X, a premature stop in codon 135 HLA (2022) 99:152-153
DPB1*712:01N Point Exon 2, 319-321AGA>TGA, causes X78, a premature stop in codon 78
DPB1*724:01N Point Exon 3, 469-471CGA>TGA, causes R128X, a premature stop in codon 128
DPB1*732:01N Point Exon 2, 469-471CGA>TGA, causes X128, a premature stop in codon 128
DPB1*738:01N Deletion Exon 2, 243delG, in codon 52, causes frameshift and premature stop in codon 87
DPB1*743:01N Point Exon 2, 262-264TGG>TAG, causes X59, a premature stop in codon 59
DPB1*748:01N Point Exon 2, 259-261TAC>TAG, causes X58, a premature stop in codon 58
DPB1*754:01N Point Exon 2, 409-411CAG>TAG, causes X108, a premature stop in codon 108
DPB1*756:01N Point Exon 2, 469-471CGA>TGA, causes X128, a premature stopn in codon 128
DPB1*777:01N Point Exon 2, 487-489CAG>TAG, causes X134, a premature stop at codon 134
DPB1*786:01:01N Point Exon 2, 473-474TGG>TAG, causes W129X, a premature stop at X129
DPB1*786:01:02N Point Exon 2, 474-476TGG>TAG, causes W129X, a premature stop at codon 129
DPB1*792:01N Point Exon 2, 645-647TGG>TAG, causes W186X, a premature stop at 186
DPB1*794:01N Point Exon 2, 580-582CAG>TAG, causes X165, a premature stop at 165
DPB1*800:01N Point Exon 2, 577-579CAG>TAG, causes Q164X, a premature stop at 164
DPB1*821:01N Point Exon 1, 330-332TAC>TAA, causes X81, a premature stop at 81
DPB1*831:01N Point Exon 1, 289-291GAG>TAG, causes X68, a premature stop at codon 68
DPB1*838:01N Point Exon 1, 171-173TAC>TAG, causes X28, a premature stop at codon 28
DPB1*844:01N Point Exon 1, 286-288GAG>TAG, causes X67, a premature stop at codon 67
DPB1*862:01N Point Exon 2, 474-476TGG>TGA, causes X129, a premature stop at codon 129
DPB1*865:01N Deletion Exon 2, 342delG, in codon 85, causes a frameshift and premature stop in codon 87
DPB1*866:01N Deletion Exon 3, 402delG, in codon 105, causes a frameshift and premature stop in codon 117
DPB1*867:01N Insertion Exon 2, 196insA, in codon 37, causes a frameshift and premature stop in codon 106
DPB1*868:01N Deletion Exon 2, 171delC, in codon 28, causes a frameshift and premature stop in codon 28
DPB1*869:01N Deletion Exon 2, 205delA, in codon 40, causes a frameshift and premature stop in codon 48
DPB1*870:01N Deletion Exon 2, 171delC, in codon 28, causes a frameshift and premature stop in codon 28
DPB1*871:01N Insertion Exon 2, 265insG, in codon 60, causes a frameshift and premature stop in codon 96
DPB1*872:01N Insertion Exon 2, 171insA, in codon 28, causes a frameshift and premature stop in codon 28
DPB1*873:01N Deletion Exon 2, 264delG, in codon 59, causes a frameshift and premature stop in codon 59
DPB1*874:01N Deletion Exon 2, 298delG, in codon 71, causes a frameshift and premature stop in codon 87
DPB1*875:01N Deletion Exon 2, 107delA, in codon 7, causes a frameshift and premature stop in codon 48.
DPB1*876:01N Insertion Exon 3, 403insG, in codon 106, causes a frameshift and a premature stop in codon 148
DPB1*877:01N Point Exon 2, 262-264TGG>TGA, causes X59, a premature stop in codon 59
DPB1*878:01N Insertion Exon 3, 391insC, in codon 102, causes frameshift and premature stop in codon 148
DPB1*894:01N Deletion Exon 3, 471delA, in codon 128, causes a frameshift and premature stop in codon 131
DPB1*911:01N Point Exon 2, 112-114TTC>TAA, causes X9, a premature stop at codon 9
DPB1*917:01N Deletion Exon 2, 192-199delCGTGCGCT, in codons 35-38, causes a frameshift and premature stop at codon 52
DPB1*919:01N Insertion Exon 2, 136-139insCTAC, in codon 17, causes a frameshift and premature stop at codon 20
DPB1*925:01N Insertion Exon 3, 415-416insAC, in codon 110, causes a frameshift and premature stop at codon 118
DPB1*939:01 Point Exon 5, 763-765CGA>TGA, causes R226X, a premature stop in codon 226
DPB1*941:01N Insertion Exon 2, 346insC, in codon 87, causes frameshift and premature stop at codon 96
DPB1*950:01N Point Exon 3, 409-411CAG>TAG, causes Q108X, a premature stop in codon 108
DPB1*959:01N Point Exon 2, 261C>G, causes X58, a premature stop at codon 58
DPB1*960:01N Deletion Exon 2, 295delC, in codon 70, causes a frameshift and premature stop in codon 87
DPB1*974:01N Insertion Exon 3, 577insC in codon 164, causes frameshift and premature stop in codon 180
DPB1*984:01N Deletion Exon 2, 277delG in codon 64, causes a frameshift and premature stop in codon 87
DPB1*985:01N Point Exon 3, 367-369CAG>TAG, causes Q94X, a premature stop in codon 94
DPB1*986:01N Insertion Exon 3, 403insG, in codon 106, causes frameshift and premature stop in codon 14
DPB1*995:01N Deletion Exon 2, 346-352delATGACCC, in codons 87-89, causes frameshift and premature stop in codon 95
DPB1*1029:01N Deletion Exon 2, 256delG, in codon 57, causes frameshift and premature stop at codon 87
DPB1*1041:01N Point Exon 2, 163-165, GAG>TAG, causes X26, a premature stop at codon 26
DPB1*1044:01N Point Exon 2, 316-218, TGC>TGA, causes X77, a premature stop at codon 77
DPB1*1045:01N Point Exon 2, 340-342, GAG>TAG, causes X85, a premature stop at codon 85
DPB1*1070:01N Deletion Exon 2, 335delT, in codon 83, causes frameshift and premature stop at codon 87
DPB1*1079:01N Point Exon 2, 175-177TAC>TAA, causes X30, a premature stop at codon 30
DPB1*1084:01N Insertion Exon 2, 189insG, in codon 35, causes a frameshift and premature stop in codon 55
DPB1*1098:01N Point Exon 3, 469-471, CGA>TGA, causes X128, a premature stop at codon 128. HLA (2020) 96:249-251
DPB1*1112:01N Insertion Exon 3, 619insA in codon 178, causes frameshift and premature stop at codon 180
DPB1*1121:01N Point Exon 2, 361-363CGA>TGA, causes R92X, a premature stop in codon 92
DPB1*1135:01N Insertion Exon 2, 286insG, in codon 67, causes a frameshift and premature stop in codon 96
DPB1*1154:01N Deletion Exon 2, 248delC in codon 54, causes frameshift and premature stop at codon 87
DPB1*1169:01N Deletion Exon 2, 145delT, in codon 19, causes a frameshift and premature stop at codon 48
DPB1*1191:01N Insertion Exon 2, 217insG in codon 44, causes frameshift and premature stop at codon 55
DPB1*1193:01N Deletion Exon 2, 342delG, in codon 85, causes a frameshift and premature stop in codon 87
DPB1*1202:01N Point Exon 3, 583-585GGA>TGA, causes X166, a premature stop at codon 166
DPB1*1228:01N Deletion Exon 2, 187delG, in codon 34, causes a frameshift and premature stop in codon 48
DPB1*1256:01N Point Exon 3, 469-471CGA>TGA causes X128, causes a premature stop at codon 128
DPB1*1260:01N Point Exon 3, 487-490CAG>TAG, causes X134, a premature stop at codon 134
DPB1*1269:01N Deletion Exon 3, 488delA, in codon 134, cause a frameshift and premature stop in codon 145
DPB1*1275:01N Point Exon 3, 580-583CAG>TAG, causes X165, a premature stop at codon 165
DPB1*1279:01N Point Exon 2, 187-189GAG>TAG, causes E34X, a premature stop in codon 34
DPB1*1285:01N Insertion Exon 2, 107insA, in codon 7, causes a frameshift and premature stop in codon 7.
DPB1*1288:01N Deletion Exon 2, 137-139delCG in codon 17, causes X18, a frameshift and premature stop at codon 18
DPB1*1291:01N Point Exon 2, 331-333GAG>TAG, causes E82X, a premature stop in codon 82
DPB1*1299:01N Insertion Exon 2, 256insG in codon 57, causes a frameshift and premature stop at codon 96
DPB1*1325:01N Deletion Exon 3, 642-647delGTGGA, causes a frameshift and premature stop in codon 189
DPB1*1332:01N Point Exon 3, 643-645TGG>TGA, causes X186, a premature stop at codon 186
DPB1*1334:01N Deletion Exon 2, 280delA in codon 65, causes a frameshift and premature stop at codon 87
DPB1*1338:01N Insertion Exon 2, 345insC in codon87, causes a frameshift and premature stop at codon 96
DPB1*1350:01N Point Exon 2, 331-333GAG>TAG, causes X82, a premature stop at codon 82
DPB1*1357:01N Point Exon 2, 271-273CAG>TAG, causes Q62X, a premature stop in codon 62
DPB1*1364:01N Deletion Exon 3, 411delG in codon 108, causes a frameshift and premature stop at codon 117
DPB1*1375:01N Deletion Exon 3, 577delC in codon 164, causes a frameshift and premature stop at codon 198
DPB1*1398:01N Insertion Exon 2, 279insGTACTGGAACAGCCAGAAGGAC, in codon 64, causes a frameshift and premature stop at codon 103
DPB1*1415:01N Insertion Exon 3, 410insA in codon 107, causes a frameshift and premature stop at codon 148
DPB1*1416:01N Point Exon 3, 538-540TGG>TGA, causes X151, a premature stop at codon 151
DPB1*1423:01N Insertion Exon 2, 263insACTG in codon 59, causes a frameshift and premature stop at codon 59
DPB1*1430:01N Deletion Exon 3, 462delTC in codon 125, causes a frameshift and premature stop at codon 147
DOA*01:04N Deletion Exon 2, 108delC, in codon 11, causes frameshift and premature stop at codon 37 Tissue Antigens (2005) 66:242-245
MICA*063N Point Exon 2, 184-186CAG>TAG, causes Q39X, a premature stop at codon 39 Tissue Antigens (2011) 78:297-298
MICA*064N Point Exon 4, 799-801TGG>TGA, causes W244X, a premature stop at codon 244 Tissue Antigens (2012) 79:313-314
MICA*088N Point Exon 4, 754-756CAG>TAG, causes Q229X, a premature stop at codon 229 HLA (2019) 94:400-401
MICA*096N Deletion Exon 2, 78-79delCA, in codons 4-5, causes frameshift and premature stop at codon 7
MICA*107N Deletion Exon 2, 146-147delTA, in codon 26, causes frameshift and premature stop at codon 36
MICA*195N Point Exon 3, 577-579CGA>TGA, causes X170, a premature stop at codon 170
MICA*222N Point Exon 4, 844-846TGC>TGA, causes X259, a premature stop at codon 259
MICA*286N Point Exon 3, 577-579CGA>TGA, causes X170, a premature stop at codon 170
MICB*009:01:01N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 Immunogenetics (1997) 46:499-508
MICB*009:01:02N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:03N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:04N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:05N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:06N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:07N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:08N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:09N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:10N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:11N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:12N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:13N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:14N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*009:01:15N Point Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170
MICB*021:01:01N Deletion Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 Tissue Antigens (2004) 64:276-280
MICB*021:01:02N Deletion Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89
MICB*021:01:03N Deletion Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89
MICB*021:01:04N Deletion Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89
MICB*021:01:05N Deletion Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89
MICB*021:01:06N Deletion Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89
MICB*021:01:07N Deletion Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89
MICB*041N Deletion Exon 3, 596delT in codon 176, causes frameshift and premature stop at codon 186
MICB*043N Deletion Exon 2, 300delG in codon 77, causes frameshift and premature stop at codon 140
MICB*045N Point Exon 4, 955-957TGT>TGA, causes C296X, a premature stop in codon 296
TAP1*01:02N Deletion Exon, 599delG, in codon 200, causes frameshift and premature stop at codon 228 Journal of Clinical Investigation (1999) 103:755-758

Alternatively Expressed Alleles

Allele Mutation Description of Mutation References
A*01:01:38L Point Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which results in low expression Human Immunology (2011) 72:717-722
A*01:147Q Point Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*01:159Q Point Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*01:208Q Point Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression HLA (2017) 90:79-87
A*01:228Q Deletion Exon 3, 388-393delGACGGG, causes deletion of codons 106-107 HLA (2017) 90:79-87
A*01:248Q Deletion Exon 7, 1085-1086delCT, in codon 338, causes frameshift and premature stop at codon 339, which may affect expression
A*01:281Q Point Exon 1, 1-3ATG>ATT, causes a non-synonymous change to the start codon, which may affect expression
A*01:301Q Point Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3
A*01:396Q Point Exon 3, 562T>A, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*02:01:01:02L Point Promoter Region, g-101T>C, causes a mutation in the Enhancer B region of the promoter Human Immunology (1994) 41:69-73
Tissue Antigens (2006) 68:442-445
A*02:01:01:134Q Point Intron 2, g475T>C, causes a mutation in the splice site proceeding exon 2, which may affect expression.
A*02:01:14Q Point Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expression HLA (2018) 91:175-186
A*02:293Q Point Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression Tissue Antigens (2011) 78:267-270
A*02:437Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*02:440Q Point Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*02:500Q Point Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*02:581Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*02:605Q Point Exon 3, 373-375TGC>TGG, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*02:618Q Deletion Exon 3, 520-531delGCCCATGTGGCG, a deletion of codons 150-153, which may affect expression
A*02:672Q Point Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression HLA (2019) 94:59-60
A*02:728Q Point Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*02:795Q Point Exon 1, 1-3ATG>TTG, causes a non-synonymous change to the start codon, which may affect expression
A*02:805Q Deletion Exon 2, 288-290delGAC, causes deletion of codon 73, which may affect expression
A*02:826Q Deletion Exon 2, 214-222delCGGGCGCCG, causes deletion of codons 48-50, which may affect expression
A*02:827Q Deletion Exon 2, 149-157delGCTACGTGG, causes deletion of codons 26-28, which may affect expression
A*02:997Q Point Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*02:1007Q Point Exon 6, 1030-1032TAC>TAG, causes Y320X, a premature stop in codon 320
A*02:1011Q Point Exon 1, 1-3ATG>GTG, causes a non-synonymouse change to the start codon, which may change expression
A*02:1041Q Point Exon 3, 562-564TGC>TAC, causes C164Y, affecting the disulphide bond, and may affect expression
A*02:1045Q Point Exon 3, 373-375TGC>TAG, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*02:1052Q Point Exon 3, 373-375TGC>AGC, causes C101S, which disrupts the disulphide bond and may affect expression
A*02:1064Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*02:1068Q Point Exon 1, 1-3ATG>AGG, causes M>R, this change affects the start codon, which may affect expression
A*03:234Q Deletion Exon 3, 520-531delGAGGCGGCCCAT, a deletion of codons 150-153, which may affect expression
A*03:388Q Insertion Exon 3, 438-440insTTA, causes insertion of codon 124, which may affect expression
A*03:437Q Point A*03 novel allele with a mutation in the stop codon, novel allele with mutation in stop codon, resulting in extension of CDS sequence by 24bp/8aa
A*11:50Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*11:52Q Deletion Exon 2, 103-105delTCC, causes deletion of codon 11, this change affects the disulphide bond altering conformation of HLA-A and affecting expression Tissue Antigens (2011) 78:195-202
A*11:170Q Point Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression HLA (2017) 90:171-173
A*11:182Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*11:235Q Deletion Exon 2, 118-123delGGCCGC, causes deletion of codons 16-17, which may affect expression HLA (2016) 87:456-458
A*11:256Q Deletion Exon 3, 409-417delTACCGGCAG, causes deletion of codons 113-115 HLA (2017) 89:302-304
A*11:272Q Deletion Exon 2, 167-175delCAGTTCGTG, causes the deletion of codons 32-34
A*11:313Q Deletion Exon 1, 30-32delCCT, causes deletion of codon -15, which may affect expression
A*11:351Q Insertion Exon 3, 595-603insCTGGAGAAC, causes insertion of codons 175-177, which may affect expression
A*11:375Q Point Cysteine at 101 changed to Serine. Disulphide bond disrupted and this may affect expression.
A*23:107Q Point Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*24:02:01:02L Point Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3 Journal of Immunology (1997) 158:5242-5250
Tissue Antigens (1997) 50:340-346
Transplantation (1999) 67:1336-1341
Tissue Antigens (2004) 63:589-591
A*24:02:01:17Q Point Intron 7, g2897A>C, causes a mutation in the splice site prior to exon 8, which may affect expression
A*24:02:03Q Point Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expression Tissue Antigens (2003) 61:325-329
A*24:294Q Deletion Exon 2, 325-327delTAC, a deletion of codon 85, which may affect expression
A*24:329Q Point Exon 3, 373-375TGC>CGC, causes C101R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression HLA (2019) 95:128-130
A*24:378Q Point Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*24:447Q Point Intron 2, g475T>C, causes a mutation in the splice site proceeding exon 2
A*24:450Q Point Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3
A*24:473Q Insertion Exon 1, 57insGCCCTG, causes insertion of codons -6 and -5, which may affect expression
A*24:479Q Point Exon 1, 1-3ATG>AAG, causes M>K, this change affects the start codon, which may affect expression
A*24:513Q Point Exon 5, 1009-1010C>A, causes Y313X, a premature stop in codon 313
A*24:536Q Deletion Exon 2, 232-235delCAG, causes the deletion of codon 55, which may affect expression
A*26:01:01:52Q Point Intron 1, g74G>A, causes a mutation in the splice site proceeding exon 1, which may affect expression
A*29:126Q Insertion Exon 3, 491-532insTGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTG, in codon 154, which may affect expression
A*30:14L Point Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression Human Immunology (2006) 67:589-596
A*30:101Q Point Exon 3, 373-375TGC>TGG, causes C101R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*30:184Q Insertion Exon 3, 417insTTC causes 116insS which may affect expression
A*31:01:02:30Q Point Intron 7, g2730G>T, causes a mutation in the splice site proceeding exon 7, which may affect expression
A*31:01:02:51Q Point Intron 4, g1948G>T, in the acceptor splice site preceeding exon 5, which may affect expression
A*31:151Q Point Exon 7, 1060-1062CAG>TAG, causes X330, a premature stop at codon 330, which may affect expression
A*31:206Q Point Exon 3, 563G>T, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*32:11Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression Tissue Antigens (2006) 68:518-520
Human Immunology (2018) 79:763-772
A*32:101Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*32:166Q Deletion Exon 2, 401-404delTCC, causes 111delL, which may affect expression
A*33:03:01:21Q Point Intron 1, g75G>T, causes a mutation in the splice site proceeding exon 1, which may affect expression
A*33:03:03Q Point Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expression Tissue Antigens (2009) 74:432-434
A*33:175Q Deletion Exon 2, 239-244delGGCCGG, causes the deletion of codons 56-57, which may affect expression
A*66:26Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*68:148Q Point Exon 3, 562-564TGC>AGC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression HLA (2017) 90:79-87
A*68:159Q Deletion Exon 2, 328-330delAAC, causes deletion of codon 86 HLA (2017) 90:79-87
A*68:263Q Insertion Exon 4, 741insGAC, causes 224insD, which may affect expression
A*68:276Q Deletion Exon 3, 547delTAC, in codon 159, causes 159delY, which may affect expression
A*68:293Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
B*07:360Q Point Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
B*07:426Q Insertion Exon 3, 478insinsAGGACCTGCGCTCCTGGACCGCCG in codons 136, causes insertion of EDLRSWTA, which may affect expression.
B*07:467Q Point Exon 3, 562-564TGC>TTC causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
B*08:270Q Point Exon 1, 1-3ATG>GTG, causes a non-synonymous change to the start codon, which may affect expression
B*08:284Q Insertion Exon 3, 491ins GGACACCGCGGC in codon 141, causes insertion of DTAA, which may affect expression.
B*08:300Q Deletion Exon 3, 473-485delCCGCGGCGGACA causes 138-141delDTAA, which may affect expression
B*13:08 Point Exon 3, 547-549TAC>TGC, causes Y159C, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
B*13:123Q Point B*13 novel allele with mutation in stop codon, resulting in extension of CDS sequence by 24bp/8aa
B*14:70Q Point Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
B*14:108Q Insertion Exon 3, 494insCACCGCGGCTCA, in codon 141, causes insertion of HTAA, which may affect expression.
B*15:01:01:39Q Point Intron 1, g201G>C, causes a mutation in the splice site preceeding exon 2, which may affect expression
B*15:01:01:65Q Point Intron 3, 993G>T in the splice site proceeding exon 3, which may affect expression
B*15:218Q Point Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression Tissue Antigens (2014) 83:184-189
B*15:245:01Q Point Exon 3, 562-564TGC>TTT, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
B*15:245:02Q Point Exon 3, 562-564TGC>TTT, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
B*15:321Q Deletion Exon 4, 742-753delCAAACTCAGGAC, a deletion of codons 224-227, which may affect expression
B*15:377Q Deletion Exon 2, 325-327delTAC, a deletion of codon 85, which may affect expression HLA (2018) 92:304-309
B*15:520Q Insertion Exon 2, 328-330insTAC, causes the insertion of codon 86, which may affect expression
B*15:546Q Deletion Exon 1, 25-27delGTC, causes the deletion of codon -16, which may affect expression
B*15:616Q Point Intron 2, 473G>C causes a mutation in the splice site proceeding exon 2, which may affect expression
B*18:01:01:12Q Point Intron 2, g716G>C, causes a mutation in the splice site prior to exon 3, which may affect expression
B*18:01:01:42Q Point Intron 2, g715A>G, causes a mutation in the splice site prior to exon 3, which may affect expression.
B*18:106Q Point Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-B and affecting expression HLA (2016) 87:31-35
B*27:05:02:04Q Point Intron 2, g716G>A, affecting splice site for exon 3, which may affect expression HLA (2018) 91:187-194
B*27:185Q Point Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
B*27:253Q Point Intron 4, g1844G>T causes a mutation in the splice site proceeding exon 4, which may affect expression
B*35:65Q Point Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expression Immunogenetics (2006) 58:929-931
Immunogenetics (2006) 58:929-931
B*35:333Q Point Exon 3, 563G>A, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
B*35:428Q Insertion Exon 2, 143-157insAGCCCCGCTTCATCG, causes the insertion of codons 24-28, which may affect expression
B*35:460Q Point Not found to be expressed on cell surface HLA (2021) 97:361-362
B*35:556Q Point Exon 3, 374G>A, causes C101Y, which disrupts the disulphide bond and may affect expression
B*37:16Q Point Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression Tissue Antigens (2014) 83:184-189
B*38:01:01:03Q Deletion Intron 2, g472delG, affecting splice site for exon 2, which may affect expression
B*38:55Q Point Exon 3, 373-375TGC>CGC, causes C101R, this change affects the disulphide bond altering conformation of HLA-B and affecting expression International Journal of Immunogenetics (2015) 42:294-296
B*38:68L Deletion Exon 4, 760-768delCTTGTGGAG, causes deletion of codons 229-231, which may affect expression Scientific Reports (2019) 9:8067-
B*38:173Q Point Exon 3, 5620564TGC>TAC, causes C164Y, this change affects the disuphide bond altering conformation of HLA-B and affecting expression
B*39:01:01:02L Deletion Promoter region, g-151-152delTC, causes a decrease in promoter activity and low expression of the allele is seen
B*39:38Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression Tissue Antigens (2006) 68:518-520
HLA (2017) 89:159-162
B*39:150Q Point Exon 1, 1-3ATG>AGG, causes M1V, this change affects the start codon, which may affect expression
B*40:02:01:32Q Point Intron 5, g2055T>C, a mutation in the splice site proceeding exon 4, which may affect expression
B*40:133Q Point Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-B and affecting expression Tissue Antigens (2014) 83:184-189
B*40:421Q Deletion Exon 2, 211-219delGCGGGCGCC, causes the codons of codons 47-49, which may affect expression
B*40:509Q Deletion Exon 4, 764-767delTGG, causes 232delV which may affect expression
B*41:56Q Point Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
B*44:02:01:02S Point Intron 4, g1934A>G, causes incorrect splicing and the deletion of 117bp (exon 5), resulting in a soluble protein Tissue Antigens (2004) 63:173-180
B*44:02:01:13Q Point Intron 3, g994T>C, causes a mutation in the splice site proceeding exon 3, which may affect expression.
B*44:02:01:39 Point 5' UTR, g-1G>C, causes a mutation in the splice site prior to exon 1
B*44:138Q Deletion Exon 3, 353-355delCCC, causes deletion of codon 94, this change affects the disulphide bond altering conformation of HLA-B and affecting expression HLA (2019) 93:89-96
B*44:160Q Point Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
B*44:480Q Deletion Exon 3, 589-594delGAGAAC, causes the deletion of codons 173-174, which may affect expression
B*46:51Q Point Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expression HLA (2017) 90:171-173
B*51:01:01:97Q Point Intron 6, g2633G>C, a mutation in the splice site preceeding exon 7, which may affect expression
B*51:173Q Point Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
B*51:329Q Insertion Exon 1, 11ins CGGCGCCCCGAACCGTCC, causes insertion of codons -20--15, which may affect expression
B*51:346Q Insertion Exon 3, 430insACG in codon 120, causes insertion of D, which may affect expression
B*56:01:01:05S Point Intron 4, g1934A>G, causes incorrect splicing and the deletion of 117bp (exon 5), resulting in a soluble protein HLA (2018) 92:250-251
B*57:98Q Point Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
C*01:121Q Point Exon 3, 562-564TGC>AGC, causes C164S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*01:185Q Deletion Exon 5, 965-972delCTGTCCTAG, causes deletion of codons 298-300, which may affect expression
C*01:238Q Point Exon 3, 373-375TGC>TTG, causes C101L, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*02:02:02:34Q Point Intron 3, g996G>T, causes a mutation in the splice site after exon 3
C*02:02:02:74Q Point Intron 2,g719A>G, a mutation in the splice site preceding exon 3, which may affect expression
C*02:25Q Point Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
HLA (2017) 90:79-87
C*02:67Q Point Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2014) 83:184-189
C*02:205Q Insertion Exon 5, 1000insGT in codon 309, causes frameshift and delayed stop in the 3'UTR region.
C*02:211Q Deletion Exon 5, 965-973delCTGTCCTAG causes the deletion of codons 298-300, which may affect expression
C*02:215Q Deletion Exon 5, 965-973delCTGTCCTAG, causes 298-300delAVL, which may affect expression
C*03:03:01:39Q Point Intron 3, g997T>A, causes a mutation in the splie site proceeding exon 3, which may affect expression
C*03:03:01:55Q Point Intron 2, g720G>C, causes a mutation in the splice site prior to exon 3
C*03:04:01:35Q Point Intron 3, g996G>A, causes a mutation in the splice site after exon 3
C*03:22Q Point Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2006) 67:343-345
C*03:169Q Point Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2014) 83:184-189
C*03:244Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
C*03:442Q Point Exon 1, 1-3ATG>GTG, causes a non-synonymous change to the start codon, which may affect expression
C*03:448Q Insertion Exon 2, 223-237insTGGGTGGAGCAGGAG, causes 56-60insWVEQE, which may affect expression
C*03:502Q Point Exon 5, 907-909CAG>TAG, causes Q279X, which may affect expression
C*03:575Q Point Exon 3, 373-375TGC>TCC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
C*03:586Q Deletion Exon 3, 407-413delGGTATG, causes 113-114delGY, which may affect expression
C*04:01:01:47Q Point Intron 4, g1860T>G, causes a mutation in the splice site after exon 4
C*04:01:01:84Q Point Intron 5, g2538G>C, causes a mutation in the splice site prior to exon 6, which may affect expression
C*04:01:01:170Q Point Intron 2, g720G>A, a mutation in the splice site preceding exon 3, which may affect expression
C*04:59Q Point Exon 3, 562-564TGC>TAG, causes C161Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
C*04:338Q Point Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*04:382Q Point Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*04:428Q Point Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond althering conformation of HLA-C and affecting expression HLA (2022) 99:370-371
C*04:456Q Deletion Exon 7, 1072delGATGAGTCTCT, causes a frameshift and premature stop in codon 337
C*05:01:01:53Q Point Intron 1, g203G>A, causes a mutation in the splice site prior to exon 2, which may affect expression
C*05:01:01:80Q Point Intron 2, g719A>C, causes a mutation in the splice site preceeding exon 3, which may affect expression
C*05:01:01:81Q Point Intron 1, g203A>G, causes a mutation in the splice site, which may affect protein expression
C*05:51Q Deletion Exon 3, 553-567delGAGGGCACGTGTGCGTG, causes deletion of codons 161-165, this change affects the disulphide bond altering conformation of HLA-C and affecting expression HLA (2017) 90:79-87
C*05:202Q Deletion Exon 2, 91-105delTATTTCTACACCGCC, causes deletion of codons 91-95, which may affect expression
C*06:74Q Point Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2014) 83:184-189
C*06:200Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*06:285Q Point Exon 1, 1-3ATG>ATA, causes a non-synonymous change to the start codon, which may affect expression
C*06:326Q Point Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering confirmation of HLA-C and affecting expression
C*06:336Q Point Exon 1, 1-3ATG>AAG, causes a non-synonymous change to the start codon, which may affect expression
C*07:01:01:14Q Point Intron 1, g203C>G, affecting splice site for exon 2, which may affect expression HLA (2018) 91:187-194
Human Immunology (2018) 79:763-772
C*07:01:01:100Q Point Intron 2, 718A>G, causes a mutation in the splice site preceeding exon 3, which may affect expression
C*07:01:01:127Q Point Intron 2, g720G>A, in the splice site preceeding exon 3, which may affect expression
C*07:02:01:74Q Point Intron 2, g2727G>A, causes a mutation in the splice site after to exon 7
C*07:02:01:118Q Point Intron 1, g202A>G, in the splice site preceding exon 2, which may affect expression
C*07:02:01:124Q Point Intron 6, g2679G>A causes a mutation in the splice sites at the end of intron 6, which may affect expression
C*07:02:01:125Q Point Intron 3, 1002T>C causes a mutation in splice site proceeding exon 2, which may effect expression.
C*07:02:01:137Q Point Intron 2, g720G>A, causes a mutation in the splice site preceeding exon 3, which may affect expression
C*07:04:01:15Q Point Intron 2, 718A>G, causes a mutation in the splice site preceeding exon 3, which may effect expression
C*07:04:01:16Q Point Intron 1, 203G>C, causes a mutation in the splice site priot to exon 2
C*07:06:01:05Q Point Intron 5, g2537G>A, causes a mutation in the splice site prior to exon 6
C*07:121Q Point Exon 3, 562-564TGC>CGC, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
C*07:150Q Insertion Exon 3, 499-500insCCCAGCGCAAGGTCAGATCAC, in codon 143, this change may affect the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2012) 79:50-57
C*07:226Q Point Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2014) 83:184-189
HLA (2017) 90:79-87
C*07:235Q Point Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*07:432Q Point Exon 3, 373-375TGC>CGC, causes C101R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*07:494Q Point Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*07:513Q Point Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression HLA (2017) 90:79-87
C*07:582Q Point Exon 3, 373-375TGC>GGC, in codon 101, causes C101G, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*07:632Q Deletion Exon 3, 598-600delAAG, causes deletion of codon 176, which may affect expression HLA (2018) 92:233-234
C*07:663Q Deletion Exon 2, 217-225delGCGCCGTGG, causes a deletion of codons 49-51, which may affect expression
C*07:697Q Point Exon 3, 373-375TGC>TGG, causes C101W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*07:713Q Point Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*07:819Q Insertion Exon 3, 556-591insGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAG, causes insertion of codons 173-184, which may affect expression
C*07:974Q Deletion Exon 2, 121-124delCGC, causes 18delR, which may affect expression
C*07:1014Q Deletion Exon 4, 817-820delGTG, which causes 249delV, which may affect expression
C*08:70Q Point Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2014) 83:184-189
C*08:141Q Point Exon 3, 375C>G, causes C101W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression HLA (2017) 90:79-87
C*08:225Q Deletion Exon 5, 978delT in codon 302, causes frameshift and premature stop at codon 303
C*12:03:01:42Q Point Intron 3, g996G>A, causes a mutation in the splice site proceeding exon 3, which may affect expression
C*12:42Q Point Exon 3, 562-564TGC>TGG, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2014) 83:184-189
C*12:139Q Point Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression HLA (2017) 90:79-87
C*12:155Q Point Exon 3, 373-375TGC>TGG, in codon 101, causes C101W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression HLA (2017) 90:79-87
C*12:330Q Deletion Exon 5, 977delC, in codon 302, causes a frameshift and premature stop in codon 303 which may affect expression
C*12:342Q Deletion Exon 5, 965-972delGGCTGTCCT, causes deletion of codons 299-301, which may affect expression
C*12:351Q Deletion Exon 5, 977delC in codon 302, causes frameshift and premature stop at codon 303. Causes a premature stop in the TM region,
C*14:105Q Deletion Exon 3, 548-550delACC, causes deletion of codon 159, which may affect expression
C*15:02:01:30Q Point Intron 1, g75T>C, causes a mutation in the splice site proceeding exon 1, which may affect expression
C*15:02:01:35Q Point Intron 2, 474G>C, causes mutation in splice site proceeding exon 2, which may affect expression
C*15:32Q Point Exon 3, 562-564TGC>GGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*15:84Q Deletion Exon 3, 550-555delCTGGAG, in codons 160-161, this change affects the disulphide bond altering conformation of HLA-C and affecting expression HLA (2017) 90:171-173
C*15:96Q Point Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2015) 86:302-303
HLA (2017) 90:79-87
C*15:105Q Deletion Exon 3, 399-401delCCT, a deletion of codon 110, which may affect expression
C*15:235Q Point Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
C*15:243Q Point Exon 3, 562-564TGC>TGG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*15:253Q Point Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression.
C*16:16Q Point Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
C*16:174Q Point Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
C*17:01:01:16Q Point Intron 2, 718A>G, causes a mutation in the splice site preceeding exon 3, which may effect expression
C*17:64Q Insertion Exon 2, 270insAAG, causes 67insK, which may affect expression
E*01:68Q Point Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-E and affecting expression HLA (2021) 97:389-398
G*01:01:01:14Q Point Intron 1, g201A>G, causes a mutation in the splice site preceeding exon 2, which may affect expression
G*01:01:02:05Q Point Intron 3, g1573G>A, affecting splice site preceeding exon 4, which may affect expression
G*01:04:01:04Q Point Intron 4, g1969A>G, causes a mutation in the splice site preceeding exon 5, which may affect expression
G*01:36Q Deletion Exon 3, 393-407delTCGCCTCCTCCGCGG causes 108-112delRLLRG, which may affect expression
G*01:38Q Point Exon 1, 1-3ATG>ACG causes a mutation in the start codon, which may affect expression
DRB1*01:91Q Deletion Exon 3, 424-426delAAC, causes deletion of codon 113, which may affect expression
DRB1*10:38Q Point DRB1*10 novel allele with a mutation in the stop codon, resulting in extension of CDS sequence by 54bp/18aa
DRB1*11:01:01:12Q Point Intron 3, g8124G>C in the splice site proceeding exon 3, which may affect expression
DRB1*11:248Q Deletion Exon 2, 285-293delCTTCCTGGA, causes the deletion of codons 66-68, which may affect expression
DRB1*11:272Q Deletion Exon 2, 280-282delAAG, causes the deletion of codon 65, which may affect expression
DRB1*11:297Q Deletion Exon 3, 502-504delAGG, causes 139delE, which may affect expression HLA (2022) 99:619-621
DRB1*13:278Q Deletion Exon 2, 193-195delGAG, causes the deletion of codon 36, which may affect expression
DRB1*14:210Q Insertion Exon 2, 164-166insGGT, causes the insertion of codon 26, which may affect expression
DRB1*15:164Q Deletion Exon 2, 193-195delGAG, causes the deletion of codon 36, which may affect expression
DRB1*15:203Q Insertion Exon 2, 195insGAG causes insertion of codon 37, which may affect expression
DRB1*16:59Q Deletion Exon 2, 320-322delACT, causes the deletion of codon 78, which may affect expression
DRB3*02:61Q Deletion Exon 2, 193-195delGAG, causes deletion of codon 36 HLA (2017) 90:186-187
DRB3*03:57Q Insertion Exon 2, 286ins AGAAGGACC, causes 67insQKD, which may affect expression
DRB5*01:79Q Deletion Exon 2, 119-124delATAAGT, causes the deletion of codons 12-13, which may affect expression
DQA1*01:07Q Point Exon 2, 304-306CGC>TGC, causes R79C, which may affect expression. Tissue Antigens (1997) 50:334-339
Human Immunology (2005) 66:1248-1253
Tissue Antigens (2014) 83:49-51
Tissue Antigens (2015) 86:413-418
DQA1*01:40Q Deletion Exon 2, 322-324delGCT, causes deletion of codon 85, which may affect expression
DQA1*03:03:01:16Q Point Intron 3, g5159G>A causes a mutation in the splice site preceeding exon 4, which may affect expression HLA (2021) 98:490-492
DQA1*05:29Q Point Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression
DQA1*05:54Q Point Exon 4, 721CGA>TGA, causes Q218X, a premature stop in codon 218
DQB1*05:87Q Deletion Exon 3, 508-510delGAG, a deletion of codon 138, which may affect expression
DQB1*05:132Q Deletion Exon 3, 508-510delGAG, causes deletion of codon 138
DQB1*06:02:01:18Q Point Intron 3, g4629G>A, causes a mutation in the splice site proceeding exon 3, which may affect expression
DQB1*06:416Q Point Exon 1, 1-3ATG>GTG, causes a non-synonymous mutation in the start codon, which may affect expression
DQB1*06:439Q Deletion Exon 2, 375-378delGAG in codon 93, causes 95delR, which may affect expression
DQB1*02:01:01:16Q Point Intron 3, 5138A>G in the splice site preceeding exon 4, which may affect expression
DQB1*02:53Q Deletion Exon 2, 289-291delAAG, a deletion of codon 65, which may affect expression HLA (2017) 90:79-87
DQB1*02:171Q Deletion Exon 2, 259-261delCTG, in codon 55, which may affect expression
DQB1*03:19:01:02Q Point Intron 3, g4627G>A, causes a mutation in the splice site after exon 3 HLA (2021) 97:171-172
DQB1*03:91Q Insertion Exon 2, 594-595insACTCCCCA, in codon 167, no internal stop codon
DQB1*03:99Q Deletion Exon 2, 189-191delCTA, in codon 31>32, no internal stop codon HLA (2017) 90:171-173
DQB1*03:197Q Deletion Exon 2, 277-282delTGGAAC, a deletion of codons 61-62, which may affect expression HLA (2017) 90:79-87
DQB1*03:480Q Deletion Exon 4, 749-756delTATCCGT, causes a frameshift and delayed stop in codon 231.
DQB1*04:02:01:16Q Point Intron 3, 4630G>A in the splice site proceeding exon 3 which may affect expression HLA (2022) 100:401-402
DPA1*01:03:01:18Q Point Intron 1, g101G>A, causes a mutation in the splice site, which may affect protein expression
DPA1*01:21Q Deletion Exon 2, 298-300delAAC, causes the deletion of codon 69, which may affect expression
DPA1*01:87Q Point Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression. HLA (2022) 99:147-148
DPA1*02:38Q Deletion Exon 4, 774-775delGG, causes frameshift and results in the extension of CDS by 78bp/26aa
DPA1*02:56Q Deletion Exon 2, 208-211delAAG, causes 38delK, which may affect expression
DPA1*02:64Q Point Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression
DPA1*03:05:01:01Q Point Exon 1, 1-3ATG>ACT, causes a non-synonymous change to the start codon, which may affect expression
DPA1*03:05:01:02Q Point Exon 1, 1-3ATG>ACT, causes a non-synonymous change to the start codon, which may affect expression
DPA1*03:05:02Q Point Exon 1, 1-3ATG>ATC in codon -31, causes a mutation in the start codon, which may affect expression
DPB1*02:01:02:46Q Point Intron 4, g10054G>A, causes a mutation in the splice site after exon 4
DPB1*697:01Q Deletion Exon 2, 274-276delAAG, in codon 63, causes deletion of codon 63
DPB1*934:01Q Insertion Exon 2, 187-189delGAG, causes deletion of codon 34, which may affect expression
DPB1*935:01Q Insertion Exon 2, 130-143insACGGCCTACGCGTT, causes 17insLRQECYA, which may affect expression
DPB1*936:01Q Deletion Exon 2, 165-170delGAGATA, causes deletion of codons 26 and 27, which may affect expression
DPB1*1038:01Q Insertion Exon 3, 636insACC, causes insertion of codon 183, which may affect expression
DPB1*1092:01Q Deletion Exon 2, 340-348delGGCGGGCCC in codons 84-86, causes 84-86delGGP, which may affect expression
DPB1*1148:01Q Deletion Exon 3, 397-399delAAG, causes 104delK, which may affect expression.
DPB1*1317:01Q Deletion Exon 4, 745-747delAGG, causes 220delR, which may affect expression
MICA*002:01:13Q Point Intron 4, g8696 in the 5' end of intron 4, causes a mutation in the splice site, which may affect splicing
MICA*011:01:04Q Point Intron 2, g7267G>A, causes a mutation in the splice site proceeding exon 2, which may affect expression
MICA*105Q Deletion Exon 3, 607-609delGAG, causes 180delR, which may affect expression
MICA*171Q Deletion Intron 2, g7267G>A, causes a mutation in the splice site proceeding exon 2, which may affect expression

Describing the mutations

The following recommendations are used for describing mutations in nucleotide sequences:

Mutations in protein sequences follow a similar format: