HLA Nomenclature

hla.alleles.org

• Nomenclature
  • How an alleles is named 
  • | Nomenclature Reports 
  • | Nomenclature Updates 
  • | Nomenclature Committee 
  • | HLA Workshops
• HLA Numbers
• Genes
• Alleles
  • Alignments 
  • | Class I Alleles 
  • | Class II Alleles 
  • | Null Alleles 
  • | Deleted Alleles 
  • | HLA Related Alleles 
• Proteins
  • Class I Proteins 
  • | Class II Proteins 
  • | Other Proteins 
• Antigens
  • Naming Antigens 
  • | Recognised Serological Specificities 
  • | Broads & Splits 
  • | Bw4 & Bw6 
  • | Previous Equivalents 
• Dictionary
• WMDA

Null and Alternatively Expressed Alleles

Assigned January 2010

We list here all HLA alleles which have been shown to either not to be expressed, Null alleles, that have the suffix 'N' and those alleles which have been shown to be alternatively expressed which may have the suffix 'L', 'S', 'C', 'A' or 'Q'.

The suffix 'L' is used to indicate an allele which has been shown to have 'Low' cell surface expression when compared to normal levels. The 'S' suffix is used to denote an allele specifying a protein which is expressed as a soluble 'Secreted' molecule but is not present on the cell surface. A 'C' suffix to indicate an allele product which is present in the 'Cytoplasm' but not on the cell surface. An 'A' suffix to indicate 'Aberrant' expression where there is some doubt as to whether a protein is expressed. A 'Q' suffix when the expression of an allele is 'Questionable' given that the mutation seen in the allele has previousÏly been shown to effect normal expression levels.

As of January 2010 no alleles have been named which use the 'C' or 'A' suffix.

All numbering is based on alignment to the exon sequence of the standard reference allele for that locus e.g.; A*01010101 for null HLA-A alleles. A full explanation of how the mutations are described is provided after the table.

Allele	Mutation	Description of Mutation	References
A*01010102N	Deletion	Intron 2, g478-481delGTGA, causes translation of intron 2 sequence and abnormal truncated peptide
A*0104N	Insertion	Exon 4, 627-628insC, in codon 186 causes frameshift and premature stop at codon 196	Laforet et al. Tissue Antigens . 1997 50:347-50 Zanone-Ramseier et al. Transplantation. 1999 67:1336-41 Poli et al. Tissue Antigens. 1999 54:300-2
A*0111N	Point mutation effecting splice site	Exon 3, 968G>T, causes alternative splice site at end of exon 3 which prevents translation into a correct and stable class I molecule expressed on the cell surface	Reinders et al. Hum Immunol. 2005 66:912-20
A*0115N	Deletion	Exon 3, 559delC, in codon 163, causes frameshift and premature stop at codon 189	Bera et al. Tissue Antigens. 2006 67:61-3
A*0116N	Insertion	Exon 3, 532-533insG, in codon 154, causes frameshift and premature stop at codon 196
A*0118N	Point	Exon 2, 215G>C, causes R48P, which may effect the binding of beta-2 microglobulin.	Henry et al. Am J. Clin. Pathol. 2004 122:185-92
A*0122N	Deletion	Exon 4, 751delG, in codon 227 causes frameshift and premature stop at codon 189
A*0127N	Point mutation leading to truncated protein	Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161	Longhi et al. Human Immunol. 2008 68:913-4
A*0131N	Point	Exon 2,250-252TGG>TAG, causes W60X, a premature stop at codon 60
A*0134N	Point mutation effecting splice site	Exon 4, 705G>A, causes incorrect splicing of exon 4
A*02010102L	Point mutation in promoter region	Promoter Region, g-101T>C, causes a mutation in the Enhancer B region	Balas et al. Hum Immunol. 1994 41:69-73 Perrier et al. Tissue Antigens. 2006 68:442-5
A*0215N	Point mutation leading to truncated protein	Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257	Ishikawa et al. Immunogenetics. 1996 43:1-5
A*0232N	Point mutation leading to truncated protein	Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141	Bunce et al. Tissue Antigens. 2000 55:31-6
A*0243N	Insertion	Exon 4, 779-780insC, in codon 236, causes frameshift and premature stop at codon 264
A*0253N	Point mutation leading to truncated protein	Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84	Wu et al. Tissue Antigens. 2002 59:328-30
A*0282N	Point mutation leading to truncated protein	Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164
A*0283N	Point mutation leading to truncated protein	Exon 4, 829-831GAG>TAG, causes Q253X, a premature stop at codon 253	Hornet al. Tissue Antigens. 2005 66:335-7
A*0288N	Point mutation leading to truncated protein	Exon 3, 418-420GAC>TAG, causes D116X, a premature stop at codon 116
A*0294N	Deletion	Exon 2, 337delG, in codon 89 causes frameshift and premature stop at codon 126
A*9213N	Point mutation leading to truncated protein	Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60	Hammond et al. Tissue Antigens. 2008 72:176-6
A*9225N	Deletion	Exon 2, 261delG, in codon 63, causes a frameshift and premature stop codon 67
A*03010102N	Point mutation effecting splice site	Intron 4, g1846G>A, causes incorrect splicing and premature stop codon
A*0303N	Deletion	Exon 3, 373-378delTGCGAC, causes deletion of codons 101-102. Codon 101 is necessary for formation of the disulphide bridge	Lienert et al. Tissue Antigens. 1996 48:187-91
A*0311N	Point mutation leading to truncated protein	Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118
A*0321N	Insertion	Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196
A*0336N	Deletion	Exon 2, 264-290delACGGAATATGAAGGCCC
A*0368N	Point mutation leading to truncated protein	Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87
A*0369N	Point mutation leading to truncated protein	Exon 3, 538-540CGG>TAG, causes R156X, a premature stop at codon 156
A*1121N	Insertion	Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196
A*2307N	Insertion	Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196
A*2308N	Point mutation leading to truncated protein	Exon 3, 562-564TGC>TGA, causes c164X, a premature stop at codon 164
A*2311N	Insertion	Exon 2, 150-151insAGCCCCGCTTCATCGCCGTGGGC, causes frameshift and premature stop codon 60
A*2319Q	Point mutation leading to questionable expression	Exon 3, 619G>A, in codon 183, mutation occurs at exon boundary, potentially affecting the splice site
A*24020102L	Point mutation effecting splice site	Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3	Magor et al. J. Immunol. 1997 158:5242-50 Laforet et al. Tissue Antigens. 1997 50:340-6 Zanone-Ramseier et al. Transplantation. 1999 67:1336-41 Dunn et al. Tissue Antigens. 2004 63:589-91
A*2409N	Point mutation leading to truncated protein	Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop at codon 224	Magor et al. J. Immunol. 1997 158:5242-50
A*2411N	Insertion	Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196	Magor et al. J. Immunol. 1997 158:5242-50
A*2436N	Deletion	Exon 2, 252-253delGG, in codon 60, causes frameshift and premature stop at codon 60	Li et al. Tissue Antigens. 2002 60:184-5
A*2440N	Deletion	Exon 4, 626-627delCC, in codon 185, causes frameshift and premature stop codon 195
A*2445N	Deletion	Exon 2, 101-102delCA, in codon 10, causes frameshift and premature stop codon 73
A*2448N	Point mutation leading to truncated protein	Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154
A*2460N	Point mutation leading to truncated protein	Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75
A*2483N	Point mutation leading to truncated protein	Exon 4, 697-699TAC>TAA, causes Y209X, a premature stop at codon 209
A*2484N	Point mutation leading to truncated protein	Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118
A*2486N	Insertion	Exon 3, 614-615insGAAGGAGACGCTGCAGC, in codon 181, causes frameshift and premature stop codon 195	Yan et al. Tissue Antigens. 2009 73:63-5
A*2490N	Point mutation leading to truncated protein	Exon 3, 418-420GAC>TAG, causes Y116X, a premature stop at codon 116
A*2611N	Insertion	Exon 3,516-517insAC, in codon 149, causes frameshift and premature stop codon 190
A*2625N	Insertion	Exon 2, 280-281insC, in codon 70, causes frameshift and premature stop at codon 74
A*29010102N	Point mutation effecting splice site	Intron 4, g1846G>A, causes incorrect splicing and premature stop codon	Elsner et al. Tissue Antigens. 2002 59:139-41
A*2908N	Point mutation leading to truncated protein	Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51
A*3014L	Point	Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression
A*3027N	Point mutation leading to truncated protein	Exon 3, 535-537GAG>TAG, causes Q155X, a premature stop at codon 155
A*3114N	Insertion	Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196	Smith et al. Tissue Antigens. 2006 68:526-7
A*3211Q	Point	Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression	Tang et al. Tissue Antigens. 2006 68:518-20
A*3219N	Point mutation leading to truncated protein	Exon 3, 571-573GGG>TGA, causes G167X, a premature stop at codon 167
A*6811N	Deletion	Exon 1,46delG, in codon 9, causes frameshift and premature stop at codon -6	Laforet et al. Tissue Antigens. 1999 53:573-5
A*6818N	Insertion	Exon 2, 213-214insCGAGCCAGAGGATGGAGCCG, in codon 48, causes frameshift and premature stop at codon 59	Dormoy et al. Tissue Antigens. 2002 60:88-90
A*7412N	Deletion	Exon 3, 357-362delCCAG AT, causes deletion of codons 96-97. Protein is not detected at cell surface by pan-class I antibody.
A*7414N	Point mutation leading to truncated protein	Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51
B*0749N	Point mutation leading to truncated protein	Exon 4, 892-894TGG>TAG, causes W274X, a premature stop at codon 274	Perrier et al. Tissue Antigens. 2007 70:341-3
B*0767N	Deletion	Exon 2, 117delC, in codon 15, causes frameshift and premature stop at codon 34
B*0808N	Deletion	Exon 3,473delC, in codon 134, causes frameshift and premature stop at codon 189	Carter et al. Tissue Antigens. 2000 55:61-4
B*0819N	Point mutation leading to truncated protein	Exon 4, 724-726CAG>TAG codon 218, causes Q218X, a premature stop at codon 218
B*0830N	Point mutation leading to truncated protein	Exon 3,424-426TAC>TAA, causes Y118X, a premature stop at codon 118
B*1307N	Deletion	Exon 2, 254-268delACCGGAA CACACAGA, codons 61-65, causes no frameshift, but exon 2 is 5aa shorter
B*1308Q	Point	Exon 3, 547-549TAC>TGC, causes Y159C, this change affects the disulphide bond altering conformation of HLA-B and affecting expression
B*1407N	Point mutation leading to truncated protein	Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164
B*15010102N	Deletion	Intron 1, g175-184delCGGGTC TCAG, effecting splice site for exon 2	Curran et al. Tissue Antigens. 1999 53:244-52
B*1526N	Point mutation leading to truncated protein	Exon 3, 367-269TAC>TAA, causes Y99X, a premature stop at codon 99	Mine et al. Tissue Antigens. 1997 50:351-4
B*1579N	Insertion	Exon 2, 328-329insCA, in codon 86, causes frameshift and premature stop at codon 127
B*1594N	Point mutation leading to truncated protein	Exon 2, 295-295CGA>TGA, causes R75X, a premature stop at codon 75
B*9511N	Deletion	Exon 3, 527-538delAGGC GGAGCA, codons 152-155, causes a frameshift and premature stop at codon 186
B*9549N	Deletion	Exon 2, 264-265delAC, in codon 65, causes frameshift and premature stop at codon 113
B*9581N	Point mutation leading to truncated protein	Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144
B*9582N	Point mutation leading to truncated protein	Exon 1, 91-93TAT>TAG, causes Y7X, a premature stop at codon 7
B*1817N	Point mutation leading to truncated protein	Exon 1, 40-42TCG>TAG, causes W-11X, a premature stop at codon -11	den Hollander et al. Tissue Antigens. 2002 59:341-3
B*1823N	Point mutation leading to truncated protein	Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180
B*2759N	Point mutation leading to truncated protein	Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72
B*3540N	Deletion	Exon 4, 807delA, in codon 245, causes frameshift and premature stop at codon 272	Dunne et al. Tissue Antigens. 2002 59:522-4
B*3553N	Deletion	Exon 3, 473-477delCCGC, in codons 134-135, causes frameshift and premature stop at codon 155
B*3565Q	Point	Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression	Elsner et al. Immunogenetics. 2006 58:929-31
B*3703N	Point mutation leading to truncated protein	Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89
B*39010102L	Deletion	Promoter region, g-151-152delTC, causes a decrease in promoter activity and low expression of the allele is seen
B*3925N	Deletion	Exon 3, 403-404delGC, in codon 111, causes frameshift and premature stop at codon 113
B*3938Q	Point mutation leading to questionable expression	Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression	Tang et al. Tissue Antigens. 2006 68:518-20
B*3940N	Point mutation leading to truncated protein	Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164
B*4022N	Point mutation leading to truncated protein	Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58	Tamouza et al. Tissue Antigens. 2000 55:378-80
B*44020102S	Point mutation effecting splice site	Intron 4, g1934A>G, causes an incorrect splicing leading to the deletion of exon 5	Dubois et al. Tissue Antigens. 2004 63:173-80
B*4419N	Deletion	Exon 1, 5delT, in codon -23, causes frameshift and premature stop codon at -6	Bettens et al. Tissue Antigens. 2000 56:441-5
B*4423N	Point mutation leading to truncated protein	Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141	Cox et al. Tissue Antigens. 2003 61:20-48 Hammond et al. Eur. J. Immunogenet. 2003 30:385-6
B*4452N	Deletion	Exon 3,492-505delTCAGATCAC CCAGC, in codons 141-144, causes frameshift and premature stop at codon 191
B*4456N	Point mutation leading to truncated protein	Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99
B*4458N	Point mutation leading to truncated protein	Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75
B*4461N	Point mutation leading to truncated protein	Exon 2,208-210GAG>TAG, causes E46X, a premature stop at codon 46
B*4607N	Point mutation leading to truncated protein	Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164	Tang et al. Tissue Antigens. 2006 68:518-20
B*4615N	Point mutation leading to truncated protein	Exon 4,736-738GAG>TAG, causes E222X, a premature stop at codon 222
B*5111N	Insertion	Exon 4, 627- 628insC, in codon 186 causes frameshift and premature stop at codon 196	Elsner et al. Tissue Antigens. 2001 57:369-72
B*5127N	Point mutation leading to truncated protein	Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144	Hou et al. Tissue Antigens. 2002 60:262-5
B*5141N	Point mutation leading to truncated protein	Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75
B*5144N	Point mutation leading to truncated protein	Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon 65
B*5405N	Deletion	Exon 2, 212-232delCGCGGGCGCCGTGGATAGAGC, in codons 46-54, causes no frameshift but deletion of 7aa
B*5408N	Point mutation leading to truncated protein	Exon 3, 553-554GAG>TAG, causes E161X, a premature stop at codon 161	Yan et al. Tissue Antigens. 2006 68:182
B*5619N	Point mutation leading to truncated protein	Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164
B*5728N	This allele has been officially named but is still confidential
B*5810N	Deletion	Exon 3, 366delG, in codon 98, causes frameshift and premature stop at codon 126
B*5817N	Deletion	Exon 3, 311delA, in codon 80, causes frameshift and premature stop at codon 126
B*8104N	Point mutation leading to truncated protein	Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58
Cw*0225Q	Point	Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression
Cw*0320N	Point mutation leading to truncated protein	Exon 1, 19-21CGA>TGA, causes R-18X, a premature stop at codon -18
Cw*0322Q	Point	Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression	Middleton et al. Tissue Antigens. 2006 67:343-5
Cw*0409N	Deletion	Exon 7, 1095delA, in codon 341, causes frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 32 amino acids	Balas et al. Tissue Antigens. 2002 59:95-100
Cw*0507N	Deletion	Exon 3, 353-353deldAD, in codon 94, causes frameshift and premature stop codon at 113
Cw*0616N	Deletion	Exon 3, 499-500delAC, in codon 144, causes a frameshift and premature stop at codon 151	Lebedeva et al. Tissue Antigens. 2007 70:441-2
Cw*0732N	Insertion	Exon 3, 560-561insCGCAGAT, in codon 163, causes frameshift and premature stop at codon 198
Cw*0733N	Deletion	Exon 2, 92delA, in codon 7, causes frameshift and premature stop at codon 76	Lazaro et al. Tissue Antigens. 2008 71:560-3
Cw*0755N	Point mutation leading to truncated protein	Exon 3,409-411TAT>TAG, causes Y113X, a premature stop at codon 113
Cw*0798N	Point mutation leading to truncated protein	Exon 3,493-495CAG>TAG, causes Q141X, a premature stop at codon 141
Cw*0826N	Point mutation leading to truncated protein	Exon 3,439-441TAC>TAG, causes Y123X, a premature stop at codon 123
Cw*1407N	Point mutation leading to truncated protein	Exon 3, 583-585TAC-TAA, causes Y171X, a premature stop at codon 171
G*0105N	Deletion	Exon 3, 460delC, in codon 130, causes frameshift and premature stop at codon 171	Suarez et al. Immunogenetics. 1997 45:464-5 Pyo et al. Immunogenetics. 2006 58:241-51
G*0113N	Point mutation leading to truncated protein	Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54	Lajoie et al. Tissue Antigens. 2008 72:502-4
DOA*0104N	Deletion	Exon 2, 108delC, in codon 11, causes frameshift and premature stop at codon 37	Moon et al. Tissue Antigens. 2005 66:242-5
DPB1*2302N	Point mutation leading to truncated protein	Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10
DPB1*6101N	Point mutation leading to truncated protein	Exon 2, 286-288GAG>TAG, causes E67X, a premature stop at codon 67	Zimmerman et al. Tissue Antigens. 1996 47:293-9
DPB1*6401N	Point mutation leading to truncated protein	Exon 2, 106-108TAC>TAA, causes Y7X, a premature stop at codon 7	Steiner et al. Tissue Antigens. 1997 49:262-6
DQA1*0403N	Point mutation leading to truncated protein	Exon 2, 236-238AAA>TAA, causes Q53X, a premature stop at codon 53	Luo et al. Tissue Antigens. 2004 63:609-11
DQB1*0626N	Point mutation leading to truncated protein	Exon 2, 181-183AGA>TGA, causes R29X, a premature stop at codon 29
DRB1*0481N	Deletion	Exon 2, 296-297delAG, in codon 70, causes frameshift and premature stop at codon 86
DRB1*0710N	Deletion	Exon 2, 175-176delTG, in codon 30, causes frameshift and premature stop at codon 32	Eiz-Vesper et al. Immunogenetics. 2007 59:507-10
DRB1*1492N	Point mutation leading to truncated protein	Exon 2, 190-192GAG>TAG, causes E35X, a premature stop at codon 35
DRB1*1517N	Insertion	Exon 2, 294-295insGA, in codon70, causes frameshift and premature stop at codon 100	Lebedeva et al. Tissue Antigens. 2005 66:334-5
DRB1*1613N	Point mutation leading to truncated protein	Exon 2, 241-243GAG>TAG, causes E52X, a premature stop at codon 52	Zhao et al. Tissue Antigens. 2008 71:180-2
DRB4*01030102N	Point mutation effecting splice site	Incorrect splicing results in lack of protein sequence	Sutton et al. Immunogenetics. 1990 31:112-7 Naruse et al. Tissue Antigens. 1997 49:152-9
DRB4*0201N	Deletion	Exon 2, 155-165delGGGTGC GGTTG, in codons 23-26, causes frameshift and premature stop at codon 29	Robbins et al. Immunogenetics. 1997 46:104-10
DRB4*0301N	Undefined	The allele contains sequence for intron 2 and exon 3, but has no preceding exon sequences	Robbins et al. Immunogenetics. 1997 46:104-10
DRB5*0108N	Deletion	Exon 3, 572-590delAAACAGTTC CTCGGAGTGG, in codons 162-168, causes frameshift and possible stop codon after 171	Voorter et al. Tissue Antigens. 1997 50:326-33
DRB5*0110N	Deletion	Exon 2, 326- 327delGA, in codon 80, causes frameshift and premature stop at codon 86	Balas et al. Tissue Antigens. 2000 55:467-9
MICB*009N	Point mutation leading to truncated protein	Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170	Ando et al. Immunogenetics. 1997 46:499-508
MICB*021N	Deletion	Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89	Schroeder et al. Tissue Antigens. 2004 64:276-80
TAP1*0102N	Point mutation effecting splice site	Exon, 599delG, in codon 200, causes frameshift and premature stop at codon 228	Furukawa et al. J. Clin. Invest. 1999 103:755-8

Describing the mutations

The following recommendations are used for describing mutations in nucleotide sequences;

• The numbering of the nucleotides in the reference sequence should remain constant.
• For both gDNA and cDNA the A of the ATG initiator Methionine codon has been denoted nucleotide +1.
• The nucleotide immediately preceding the A of the ATG initiator Methionine codon has been denoted nucleotide -1. Note: that there is no nucleotide 0.
• gDNA numbering is identified by the prefix g. For example; g708G>A refers to position 708 of the gDNA and not 708 of the cDNA sequence.
• Nucleotide substitutions are designated using the nucleotide number, followed by the substitution. For example; 997G>T denotes a substitution of G to T at position 997 of the DNA sequence.
• Deletions are designated by 'del' after the nucleotide number. For example; 997delT denotes the deletion of a T at position 997 of the DNA. For deletions of a number of consecutive bases the mutation should be described as 997-998delTG which denotes a deletion of TG at positions 997 and 998 of the DNA.
• Insertions are designated by 'ins' after the nucleotide numbers bordering the insertion. For example; 997-998insT, represents an insertion of T between bases 997 and 998 of the DNA. In the alignments produced this will be represented by a period (.), but the numbering of the reference sequence will not be altered to include this base. Insertions of multiple bases are designated using the same form, 997-998insTG denotes an insertion of TG between positions 997 and 998 of the DNA.

Mutations in protein sequences follow a similar format;

• The numbering of the amino acids in the reference sequence should remain constant.
• For amino acid-based systems, the start codon of the mature protein is labeled codon 1.
• The codon 5' to this is numbered -1.
• For amino acid nomenclature the reference amino acid is listed first followed by the codon and then the mutation. For example; Y97S represents a substitution of the Tyrosine at codon 97 for a Serine.
• Stop codons are always designated by X. For example; T97X represents a Threonine substituted for a stop codon.
• Deletions are again designated used 'del'. For example; T97del is the deletion of a Threonine at codon 97.
• Insertions again follow the 'ins' convention. For example; T97-98ins represents a Threonine inserted between codons 97 and 98

Also available

Alignments

Class I Alleles

Class II Alleles

Null Alleles

Deleted Alleles

Other Non-HLA Alleles

In association with;
HLA Informatics Group

IMGT/HLA Database
Supported by;

| Contact Us | Copyright © Anthony Nolan Research Institute | Last Updated: 26-01-2010|