Null and Alternatively Expressed Alleles
Assigned up to April 2013
We list here all HLA alleles which have been shown to either not to be expressed, Null alleles, that have the suffix 'N' and those alleles which have been shown to be alternatively expressed have the suffix 'L', 'S', 'C', 'A' or 'Q'.
The suffix 'L' is used to indicate an allele which has been shown to have 'Low' cell surface expression when compared to normal levels. The 'S' suffix is used to denote an allele specifying a protein which is expressed as a soluble 'Secreted' molecule but is not present on the cell surface. A 'C' suffix to indicate an allele product which is present in the 'Cytoplasm' but not on the cell surface. An 'A' suffix to indicate 'Aberrant' expression where there is some doubt as to whether a protein is expressed. A 'Q' suffix when the expression of an allele is 'Questionable' given that the mutation seen in the allele has previousÏly been shown to effect normal expression levels.
As of October 2012 no alleles have been named which use the 'C' or 'A' suffix.
All numbering is based on alignment to the exon sequence of the standard reference allele for that locus e.g.; A*01:01:01:01 for null HLA-A alleles. A full explanation of how the mutations are described is provided after the table.
Null Alleles
| Allele | Mutation | Description of Mutation | References |
|---|---|---|---|
| A*01:01:01:02N | Deletion |
Intron 2, g478-481delGTGA, causes translation of intron 2 sequence and abnormal truncated peptide | |
| A*01:04N | Insertion |
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | Laforet et al. Tissue Antigens. 1997 50:347-50 Zanone-Ramseier et al. Transplantation. 1999 67:1336-41 Poli et al. Tissue Antigens. 1999 54:300-2 |
| A*01:11N | Point |
Exon 3, 968G>T, causes alternative splice site at end of exon 3 which prevents translation into a correct and stable class I molecule expressed on the cell surface | Reinders et al. Hum Immunol. 2005 66:912-20 |
| A*01:15N | Deletion |
Exon 3, 559delC, in codon 163, causes frameshift and premature stop at codon 189 | Bera et al. Tissue Antigens. 2006 67:61-3 Lazaro et al. Tissue Antigens. 2009 73:364-72 2009 |
| A*01:16N | Insertion |
Exon 3, 532-533insG, in codon 154, causes frameshift and premature stop at codon 196 | |
| A*01:18N | Point |
Exon 2, 215G>C, causes R48P, which may effect the binding of beta-2 microglobulin. | Henry et al. Am J. Clin. Pathol. 2004 122:185-92 |
| A*01:22N | Deletion |
Exon 4, 751delG, in codon 227 causes frameshift and premature stop at codon 189 | |
| A*01:27N | Point |
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161 | Longhi et al. Human Immunol. 2008 68:913-4 |
| A*01:31N | Point |
Exon 2,250-252TGG>TAG, causes W60X, a premature stop at codon 60 | |
| A*01:52N | Point | Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 | |
| A*01:53N | Point | Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159 | |
| A*01:56N | Point | Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217 | |
| A*01:57N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | |
| A*01:87N | Deletion | Exon 4, 723delG, in codon 217, causes frameshift and premature stop at codon 272 | |
| A*01:123N | Deletion | Exon 2, 610delC, in codon 180, causes frame shift and premature stop codon at codon 189 | |
| A*02:15N | Point |
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 | Ishikawa et al. Immunogenetics. 1996 43:1-5 |
| A*02:32N | Point |
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | Bunce et al. Tissue Antigens. 2000 55:31-6 |
| A*02:43N | Insertion |
Exon 4, 779-780insC, in codon 236, causes frameshift and premature stop at codon 264 | |
| A*02:53N | Point |
Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84 | Wu et al. Tissue Antigens. 2002 59:328-30 |
| A*02:82N | Point |
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
| A*02:83N | Point |
Exon 4, 829-831GAG>TAG, causes Q253X, a premature stop at codon 253 | Horn et al. Tissue Antigens. 2005 66:335-7 |
| A*02:88N | Point |
Exon 3, 418-420GAC>TAG, causes D116X, a premature stop at codon 116 | |
| A*02:94N | Deletion |
Exon 2, 337delG, in codon 89, causes frameshift and premature stop at codon 126 | |
| A*02:113N | Point |
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 | Hammond et al. Tissue Antigens. 2008 72:176-6 |
| A*02:125N | Deletion |
Exon 2, 261delG, in codon 63, causes a frameshift and premature stop codon 67 | Anholts et al. Tissue Antigens. 2009 74:424-8 |
| A*02:222N | Point | Exon 3, 451-453AAA>TAA, causes K127X, a premature stop at codon 127 | |
| A*02:223N | Point | Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 | |
| A*02:225N | Point | Exon 3, 439-441TAC>TAA, causes Y123X, a premature stop at codon 123 | |
| A*02:226N | Point | Exon 3, 538-540TTG>TAG, causes L156X, a premature stop at codon 156 | |
| A*02:227N | Point | Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 | |
| A*02:395N | Point | Exon 2, 268A>T, causes N66X, a premature stop at codon 66 | |
| A*02:250N | Deletion | Exon 2, 286-287delCA, in codons 71-72, causes frameshift and premature stop at codon 195 | |
| A*02:284N | Point | Exon 3, 391-393TGG>TAG, causes W107X, a premature stop at codon 107 | |
| A*02:301N | Deletion | Exon 3, 426delC, in codon 118, causes frameshift and premature stop at codon 118 | |
| A*02:305N | Deletion | Exon 4, 814delG, in codon 248, causes frameshift and premature stop at codon 272 | |
| A*02:314N | Point | Exon 3, 408-411 TAC>TAG, causes Y113X, a premature stop at codon 113 | |
| A*02:321N | Point | Exon 2, 244-246GAG>TAG, causes Q58X, premature stop at codon 58 | |
| A*02:350N | Point | Exon 2, 337-339GAG>TAG causes E89X, a premature stop at codon 89 | |
| A*02:356N | Point | Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 | |
| A*02:366N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
| A*02:373N | Point | Exon 3, 514-516GAG>TAG, causes E148X, a premature stop at codon 148 | |
| A*03:01:01:02N | Point |
Intron 4, g1846G>A, causes incorrect splicing and premature stop codon | |
| A*03:03N | Deletion |
Exon 3, 373-378delTGCGAC, causes deletion of codons 101-102. Codon 101 is necessary for formation of the disulphide bridge | Lienert et al. Tissue Antigens. 1996 48:187-91 |
| A*03:11N | Point |
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
| A*03:21N | Insertion |
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | |
| A*03:36N | Deletion |
Exon 2, 264-290delACGGAATATGAAGGCCC | |
| A*03:68N |
Point
|
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 | |
| A*03:69N | Point |
Exon 3, 538-540CGG>TAG, causes R156X, a premature stop at codon 156 | |
| A*03:91N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | |
| A*03:129N | Deletion | Exon 4, 651delC, in codon 193, causes frameshift and premature stop at codon 201 | |
| A*03:161N | Point | Exon 2, 127-129 GAG>TAG, causes E19X, a premature stop at codon 19 | |
| A*03:162N | Insertion | Exon 3, 664-665insCATG, in codon 198, causes frame shift and premature stop at codon 199 | |
| A*11:21N | Insertion |
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | |
| A*11:69N | Point | Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217 | |
| A*11:78N | Deletion | Exon 2, 285-286delAC, causes frameshift and premature stop codon at 73 | |
| A*11:99N | Deletion | Exon 2, 153delC, in codon 27, causes frameshift and premature stop at codon 27 | |
| A*11:109N | Point | Exon 3, 511-514TGG>TGA, causesW147X, a premature stop at codon 147 | |
| A*11:115N | Point | Exon 2, 151-153TAC>TAA , causes Y27X, a premature stop at codon 27 | |
| A*11:127N | Point | Exon 3, 583-585TAC>TAA , causes Y171X, a premature stop at codon 171 | |
| A*11:137N | Point | Exon 3, 426C>G, causes Y118X, a premature stop at codon 118 | |
| A*23:07N | Insertion |
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | |
| A*23:08N | Point |
Exon 3, 562-564TGC>TGA, causes c164X, a premature stop at codon 164 | |
| A*23:38N | Deletion | Exon 2, 303delC in codon 77, causes frameshift and premature stop at codon 97 | |
| A*23:11N | Insertion |
Exon 2, 150-151insAGCCCCGCTTCATCGCCGTGGGC, causes frameshift and premature stop codon 60 | |
| A*24:09N | Point |
Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop at codon 224 | Magor et al. J. Immunol. 1997 158:5242-50 |
| A*24:11N | Insertion |
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | Magor et al. J. Immunol. 1997 158:5242-50 |
| A*24:36N | Deletion |
Exon 2, 252-253delGG, in codon 60, causes frameshift and premature stop at codon 60 | Li et al. Tissue Antigens. 2002 60:184-5 |
| A*24:40N | Deletion |
Exon 4, 626-627delCC, in codon 185, causes frameshift and premature stop codon 195 | |
| A*24:45N | Deletion |
Exon 2, 101-102delCA, in codon 10, causes frameshift and premature stop codon 73 | |
| A*24:48N | Point |
Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154 | |
| A*24:60N | Point |
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
| A*24:83N | Point |
Exon 4, 697-699TAC>TAA, causes Y209X, a premature stop at codon 209 | |
| A*24:84N | Point |
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
| A*24:86N | Insertion |
Exon 3, 614-615insGAAGGAGACGCTGCAGC, in codon 181, causes frameshift and premature stop codon 195 | Yan et al. Tissue Antigens. 2009 73:63-5 |
| A*24:90N | Point |
Exon 3, 418-420GAC>TAG, causes Y116X, a premature stop at codon 116 | |
| A*24:132N | Point | Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101 | |
| A*24:155N | Deletion | Exon 4, 740delA, causes frameshift and premature stop codon at 272 | |
| A*24:158N | Deletion | Exon 3, 453-454delCG, causes frameshift and premature stop at codon 195 | |
| A*24:163N | Deletion | Exon 4/5, 895-897GAG>TAG, causesW275X, a premature stop at codon 275 | |
| A*24:183N | Point | Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 | |
| A*24:185N | Point | Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 | |
| A*24:222N | Deletion | Exon 3, 355-357delC, in codon 95, causes frame shift and premature stop at codon 97 | |
| A*24:232N | Insertion | Exon 2, 113-114insTCCCG, in codon 14, causes a frame shift and a premature stop codon at codon 60 | |
| A*25:12N | Point | Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159 | |
| A*26:11N | Insertion |
Exon 3, 516-517insAC, in codon 149, causes frameshift and premature stop codon 190 | |
| A*26:25N | Insertion |
Exon 2, 280-281insC, in codon 70, causes frameshift and premature stop at codon 74 | |
| A*26:60N | Point | Exon 3, 424-426>TAC>TAG, causes Y118X, a premature stop at codon 118 | |
| A*26:71N | Point | Exon 2, 223-225>TGG>TAG, causes W51X, a premature stop at codon 51 | |
| A*29:01:01:02N | Point |
Intron 4, g1846G>T, causes incorrect splicing and premature stop codon | Elsner et al. Tissue Antigens. 2002 59:139-41 |
| A*29:08N | Point |
Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51 | |
| A*30:27N | Point |
Exon 3, 535-537GAG>TAG, causes Q155X, a premature stop at codon 155 | |
| A*30:59N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | |
| A*30:70N | Delewtion | Exon 2, 208-210delG, in codon 46, causes frame shift and premature stop at codon 52 | |
| A*30:73N | Insertion | Exon 3, 516-517insCGGACATGGCGGCTCAGATCACCCAGCGCAAGTGGGAG, in codon 148, causes a frame shift and a premature stop codon at codon 169 | |
| A*31:14N | Insertion |
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | Smith et al. Tissue Antigens. 2006 68:526-7 |
| A*31:60N | Point | Exon 3, 373-375TGC>TGA , causes G101X, a premature stop at codon 101 | |
| A*32:19N | Point |
Exon 3, 571-573GGG>TGA, causes G167X, a premature stop at codon 167 | Balas A et al. Tissue Antigens. 2009 74:553-4 |
| A*32:27N | Point | Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 | |
| A*32:45N | Point | Exon 3, 508-510AAG>TAG, causes K146X, a premature stop at codon 146 | |
| A*32:48N | Point | Exon 3, 409-411 TAC>TAG, causes Y113X, a premature stop at codon 113 | |
| A*32:56N | Deletion | Exon 2, 233delA, in codon 54, causes frame shift and premature stop codon at codon 67 | |
| A*34:10N | Point | Exon 3, 415-417 CAG-TAG, causes Q115X, a premature stop at codon 115 | |
| A*68:11N | Deletion |
Exon 1,46delG, in codon 9, causes frameshift and premature stop at codon -6 | Laforet et al. Tissue Antigens. 1999 53:573-5 |
| A*68:18N | Insertion |
Exon 2, 213-214insCGAGCCAGAGGATGGAGCCG, in codon 48, causes frameshift and premature stop at codon 59 | Dormoy et al. Tissue Antigens. 2002 60:88-90 |
| A*68:49N | Point | Exon 3,511-513TGG>TAG, causes W147X, a premature stop at codon 147 | |
| A*68:59N | Point | Exon 3, 511-513TGG>TAG, causes W147X, a premature stop at codon 147 | |
| A*68:94N | Point | Exon 2, 253-255TGG>TAG , causes W51X, a premature stop at codon 51 | |
| A*74:12N | Deletion |
Exon 3, 357-362delCCAG AT, causes deletion of codons 96-97. Protein is not detected at cell surface by pan-class I antibody. | |
| A*74:14N | Point |
Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51 | |
| B*07:49N | Point |
Exon 4, 892-894TGG>TAG, causes W274X, a premature stop at codon 274 | Perrier et al. Tissue Antigens. 2007 70:341-3 |
| B*07:67N | Deletion |
Exon 2, 117delC, in codon 15, causes frameshift and premature stop at codon 34 | |
| B*07:111N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | |
| B*07:135N | Point | Exon 3, 553-555GAG>TAG, causes G161X, premature stop at codon 161 | |
| B*07:161N | Insertion | Exon 5, 151T, in codon 297, causes a frame shift and premature stop at codon 308 | |
| B*07:167N | Point | Exon 3, 502-504 CAG-TAG, causes Q144X, a premature stop at codon 144 | |
| B*07:181N | Point | Exon 2, 265C>T, causes Q65X, a premature stop at codon 65 | |
| B*07:182N | Point | Exon 3, 420C>A, causes Y116X, a premature stop codon at 116 | |
| B*08:08N | Deletion |
Exon 3,473delC, in codon 134, causes frameshift and premature stop at codon 189 | Carter et al. Tissue Antigens. 2000 55:61-4 |
| B*08:19N | Point |
Exon 4, 724-726CAG>TAG codon 218, causes Q218X, a premature stop at codon 218 | |
| B*08:30N | Point |
Exon 3,424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
| B*08:67N | Point | Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51 | |
| B*08:72N | Point | Exon 2, 295-297CGA>TGA, causes R75X, premature stop at codon 75 | |
| B*08:82N | Point | Exon 3, 589-591GAG>TAG, causes E173X, a premature stop at codon 173 | |
| B*08:86N | Point | Exon 3, 571-573TGG>TGA, causes W167X, a premature stop at codon 167 | |
| B*13:07N | Deletion |
Exon 2, 254-268delACCGGAA CACACAGA, codons 61-65, causes no frameshift, but exon 2 is 5aa shorter | |
| B*13:49N | Point | Exon 3, 439-441TAC>TAA, causes Y123X, premature stop at codon 123 | |
| B*13:56N | Point | Exon 3, 424-426TAC>TAA, casues Y118X, premature stop at codon 118 | |
| B*13:63N | Insertion | Exon 3, 583-585insA, in codon 171, causes frame shift and premature stop at codon 171 | |
| B*14:07N | Point |
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
| B*15:01:01:02N | Deletion |
Intron 1, g175-184delCGGGTC TCAG, effecting splice site for exon 2 | Curran et al. Tissue Antigens. 1999 53:244-52 |
| B*15:26N | Point |
Exon 3, 367-269TAC>TAA, causes Y99X, a premature stop at codon 99 | Mine et al. Tissue Antigens. 1997 50:351-4 |
| B*15:79N | Insertion |
Exon 2, 328-329insCA, in codon 86, causes frameshift and premature stop at codon 127 | |
| B*15:94N | Point |
Exon 2, 295-295CGA>TGA, causes R75X, a premature stop at codon 75 | |
| B*15:111N | Deletion |
Exon 3, 527-538delAGGC GGAGCA, codons 152-155, causes a frameshift and premature stop at codon 186 | |
| B*15:149N | Deletion |
Exon 2, 264-265delAC, in codon 65, causes frameshift and premature stop at codon 113 | Zou et al. Tissue Antigens. 2009 74:447-9 |
| B*15:181N | Point |
Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144 | |
| B*15:182N | Point |
Exon 2, 91-93TAT>TAG, causes Y7X, a premature stop at codon 7 | |
| B*15:190N | Point | Exon 3,511-513TGG>TGA, causes W147X, a premature stop at codon 147 | |
| B*15:209N | Point | Exon 3, 469-471TGG>TGA, causes W133X, a premature stop at codon 133 | |
| B*15:226N | Point | Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87 | |
| B*15:246N | Deletion | Exon 2, 264-265delAC, in codon 65, causes frameshift and premature stop at codon 113 | |
| B*15:258N | Point | Exon 3, 583-585 TAC-TAA, causes Y171X, a premature stop at codon 171 | |
| B*15:262N | Point | Exon 3,367-369insGACG, in codon 99, causes frame shift and premature stop at codon 115 | |
| B*15:272N | Point | Exon 3, 426C>G, causes Y118X, a premature stop codon at 118 | |
| B*18:17N | Point |
Exon 1, 40-42TCG>TAG, causes W-11X, a premature stop at codon -11 | den Hollander et al. Tissue Antigens. 2002 59:341-3 |
| B*18:23N | Point |
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 | |
| B*18:74N | Point | Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161 | |
| B*27:59N | Point |
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 | |
| B*27:64N | Point |
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | |
| B*27:65N | Point |
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 | |
| B*27:94N | Point | Exon 2, 250-252 TGG-TAG, causes W60X, a premature stop at codon 60 | |
| B*35:40N | Deletion |
Exon 4, 807delA, in codon 245, causes frameshift and premature stop at codon 272 | Dunne et al. Tissue Antigens. 2002 59:522-4 |
| B*35:53N | Deletion |
Exon 3, 473-477delCCGC, in codons 134-135, causes frameshift and premature stop at codon 155 | |
| B*35:129N | Point | Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 | |
| B*35:130N | Point | Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27 | |
| B*35:134N | Point | Exon 4, 782-784TGG>TGA, causes W224X, a premature stop at 224 | |
| B*35:145N | Insertion | Exon 3, 532-533insGCGG, in codon 154 causes a frameshift and premature stop codon at 197 | |
| B*35:165N | Point | Exon 3,373-375TGC>TGA, causes C101X, a premature stop at 101 | |
| B*35:173N | Point | Exon 2, 222-225TGG>TAG, causes W51X, premature stop at codon 51 | |
| B*35:216N | Point | Exon 2, 331-333 CAG-TAG, causes Q87X, a premature stop at codon 87 | |
| B*37:03N | Point |
Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89 | |
| B*37:30N | Point | Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133 | |
| B*37:33N | Point | Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 | |
| B*38:34N | Point | Exon 2, 286-288CAG>TAG, causes Q72X, premature stop at codon 72 | |
| B*39:25N | Deletion |
Exon 3, 403-404delGC, in codon 111, causes frameshift and premature stop at codon 113 | |
| B*39:40N | Point |
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
| B*39:40:02N | Point | Exon 3, 562-564 TGC-TGA, causes C164X, a premature stop at codon 164 | |
| B*40:22N | Point |
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 | Tamouza et al. Tissue Antigens. 2000 55:378-80 |
| B*40:118N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | |
| B*40:142N | Deletion | Exon 2, 253delG, in codon 61, causes frameshift and premature stop at codon 251 | |
| B*40:144N | Point | Exon 4, 826-828GGA>TGA, causes G252X, a premature stop at codon 252 | |
| B*40:155N | Insertion | Exon 3, 593-594insAGAAC, in codon 174, causes frameshift and premature stop at codon 191 | |
| B*44:19N | Deletion |
Exon 1, 5delT, in codon -23, causes frameshift and premature stop codon at -6 | Bettens et al. Tissue Antigens. 2000 56:441-5 |
| B*44:23N | Point |
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | Cox et al. Tissue Antigens. 2003 61:20-48 Hammond et al. Eur. J. Immunogenet. 2003 30:385-6 |
| B*44:52N | Deletion |
Exon 3,492-505delTCAGATCAC CCAGC, in codons 141-144, causes frameshift and premature stop at codon 191 | |
| B*44:56N | Point |
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 | Tijssen et al. Tissue Antigens. 2009 73:607-9 |
| B*44:58N | Point |
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | Lazaro et al. Tissue Antigens. 2009 74:238-40 |
| B*44:61N | Point |
Exon 2,208-210GAG>TAG, causes E46X, a premature stop at codon 46 | |
| B*44:108N | Point | Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 | |
| B*44:149N | Point | Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop at codon 96 | |
| B*44:171N | Point | Exon 2, 259A>T, causes E63X, a premature stop at codon 63 | |
| B*46:07N | Point |
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | Tang et al. Tissue Antigens. 2006 68:518-20 |
| B*46:15N | Point |
Exon 4,736-738GAG>TAG, causes E222X, a premature stop at codon 222 | |
| B*49:19N | Point | Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133 | |
| B*51:11N | Insertion |
Exon 4, 627- 628insC, in codon 186 causes frameshift and premature stop at codon 196 | Elsner et al. Tissue Antigens. 2001 57:369-72 |
| B*51:27N | Point |
Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144 | Hou et al. Tissue Antigens. 2002 60:262-5 |
| B*51:41N | Point |
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
| B*51:44N | Point |
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon 65 | |
| B*51:98N | Point | Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 | |
| B*51:110N | Point | Exon 2, 325-327TAC>TAG, causes Y85X, a premature stop codon 85 | |
| B*51:118N | Deletion | Exon 2, 264-265delAC, in codons 64-65, causes frameshift and premature stop at codon 113 | |
| B*51:149N | Deletion | Exon 3, 611delA, in codon 180, causes frame shift and premature stop codon at codon 189 | |
| B*54:05N | Deletion |
Exon 2, 212-232delCGCGGGCGCCGTGGATAGAGC, in codons 46-54, causes no frameshift but deletion of 7aa | |
| B*54:08N | Point |
Exon 3, 553-554GAG>TAG, causes E161X, a premature stop at codon 161 | Yan et al. Tissue Antigens. 2006 68:182 |
| B*55:55N | Point | Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159 | |
| B*56:19N | Point |
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
| B*56:28N | Point | Exon 2, 247-249TGG>TGA, causes W59X, a premature stop at codon 59 | |
| B*56:38N | Point | Exon 2, 166-168 CAG-TAG, causes Q32X, a premature stop at codon 32 | |
| B*57:28N | Point | Exon 3, 418-420TAC>TAG, causes Y116X, a premature stop at codon 116 | Cosentini et al. Int. J. Immunogenetics 2010 37:299-300 |
| B*58:10N | Deletion |
Exon 3, 366delG, in codon 98, causes frameshift and premature stop at codon 126 | |
| B*58:17N | Deletion |
Exon 3, 311delA, in codon 80, causes frameshift and premature stop at codon 126 | Lazaro et al. Tissue Antigens. 2009 73:364-72 2009 |
| B*58:31N | Deletion | Exon 4, 872-894delCGAAGCCCCTCACCCTGAGATGG, causes a premature stop at codon 300 | |
| B*58:39N | Point | Exon 2, 208-210 GAG-TAG, causes E46X, a premature stop at codon 46 | |
| B*81:04N | Point |
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 | Lazaro et al. Tissue Antigens. 2009 73:364-72 2009 |
| C*01:37N | Point |
Exon 2, 361-363TGG>TGA, causes W97X, a premature stop at codon 97 | |
| C*01:56N | Point | Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 | |
| C*01:69N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
| C*02:38N | Point |
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 | |
| C*02:52N | Point | Exon 2, 151-153TAC>TAA, causes Y27X, premature stop at codon 27 | |
| C*03:20N | Point |
Exon 1, 19-21CGA>TGA, causes R-18X, a premature stop at codon -18 | |
| C*03:121N | Point | Exon 3, 511-513TGG>TGA, causes W147X, premature stop at codon 147 | |
| C*03:189N | Point | Exon 2, 153C>G, causes Y27X, a premature stop codon at 27 | |
| C*04:09N | Deletion |
Exon 7, 1095delA, in codon 341, causes frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 32 amino acids | Balas et al. Tissue Antigens. 2002 59:95-100 |
| C*04:88N | Point | Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87 | |
| C*04:93N | Point | Exon 3, 373-375TGC>TGA, causes C101X, premature stop at codon 101 | |
| C*04:95N | Point | Exon 3, 547-549TAC>TAA, causes W159X, premature stop at codon 159 | |
| C*04:105N | Point | Exon 2, 247-249TAT>TAG, causes Y59X, a premature stop at codon 59 | |
| C*04:115N | Point | Exon 2, 49-51GAG>TAG, causes A49X, a premature stop at codon 49 | |
| C*04:123N | Point | Exon 2, 115-117CAG>TAG, causes Q115X, a premature stop at codon 115 | |
| C*05:07N | Deletion |
Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop codon at 113 | |
| C*05:48N | Point | Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32 | |
| C*05:91N | Point | Exon 2, 337T>G, causes E89X, a premature stop codon at 89 | |
| C*06:16N | Deletion |
Exon 3, 499-500delAC, in codon 144, causes a frameshift and premature stop at codon 151 | Lebedeva et al. Tissue Antigens. 2007 70:441-2 |
| C*06:46N | Point | Exon 4, 742-744CAA>TAA, causes Q224X, a premature stop at codon 224 | |
| C*06:49N | Point | Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101 | |
| C*06:79N | Point | Exon 3, 538-540TGG>TGA, causes R156X, a premature stop at codon 156 | |
| C*07:32N | Insertion |
Exon 3, 560-561insCGCAGAT, in codon 163, causes frameshift and premature stop at codon 198 | |
| C*07:33N | Deletion |
Exon 2, 92delA, in codon 7, causes frameshift and premature stop at codon 76 | Lazaro et al. Tissue Antigens. 2008 71:560-3 |
| C*07:55N | Point |
Exon 3,409-411TAT>TAG, causes Y113X, a premature stop at codon 113 | |
| C*07:98N | Point |
Exon 3,493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | |
| C*07:104N | Point | Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
| C*07:152N | Point | Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
| C*07:164N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at 85 | |
| C*07:191N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | |
| C*07:198N | Point | Exon 2, 202-204AGA>TGA, causes R44X, premature stop at codon 44 | |
| C*07:227N | Point | Exon 2, 124-126GGA>TGA, causes 18GX, premature stop at codon 18 | |
| C*07:264N | Point | Exon 3, 535-537 CAG-TAG, causes Q155X, a premature stop at codon 155 | |
| C*08:36N | Point |
Exon 3,439-441TAC>TAG, causes Y123X, a premature stop at codon 123 | |
| C*08:52N | Deletion | Exon 4, 678delG, in codon 202, causes frameshift and premature stop at codon 215 | |
| C*08:55N | Point | Exon 2, 175-178CGG>TAG, causes R35X, a premature stop at codon 35 | |
| C*12:39N | Point |
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 | |
| C*12:46N | Point | Exon 3, 424-429TAC>TAG, causes Y118X, a premature stop at codon 118 | |
| C*12:80N | Point | Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 | |
| C*12:84N | Insertion | Exon 2, 202-204insA, in codon 44, causes frame shift and premature stop at codon 75 | |
| C*14:07N | Point |
Exon 3, 583-585TAC-TAA, causes Y171X, a premature stop at codon 171 | |
| C*14:21N | Point |
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
| C*14:35N | Point | Exon 3 361-363TGG>TGA, causes W97X, premature stop at codon 97 | |
| C*14:47N | Point | Exon 3, 471G>A, causes W133X, a premature stop at codon 133 | |
| C*16:30N | Point | Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87 | |
| G*01:05N | Deletion |
Exon 3, 460delC, in codon 130, causes frameshift and premature stop at codon 171 | Suarez et al. Immunogenetics. 1997 45:464-5 Pyo et al. Immunogenetics. 2006 58:241-51 |
| G*01:13N | Point |
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 | Lajoie et al. Tissue Antigens. 2008 72:502-4 |
| DOA*01:04N | Deletion |
Exon 2, 108delC, in codon 11, causes frameshift and premature stop at codon 37 | Moon et al. Tissue Antigens. 2005 66:242-5 |
| DPB1*23:02N | Point |
Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10 | |
| DPB1*61:01N | Point |
Exon 2, 286-288GAG>TAG, causes E67X, a premature stop at codon 67 | Zimmerman et al. Tissue Antigens. 1996 47:293-9 |
| DPB1*64:01N | Point |
Exon 2, 106-108TAC>TAA, causes Y7X, a premature stop at codon 7 | Steiner et al. Tissue Antigens. 1997 49:262-6 |
| DPB1*154:01N | Point | Exon 2, 271C>T, causes Q62X, a premature stop codon at 62 | |
| DPB1*159:01N | Point | Exon 2, 361C>T, causes R92X, a premature stop codon at 92 | |
| DPB1*161:01N | Point | Exon 2, 340G>T, causes E85X, a premature stop codon at 85 | |
| DQA1*04:03N | Point |
Exon 2, 236-238AAA>TAA, causes Q53X, a premature stop at codon 53 | Luo et al. Tissue Antigens. 2004 63:609-11 |
| DQB1*02:18N | Point | Exon 2, 279G>A, causes W61X, a premature stop codon at 61 | |
| DQB1*02:20N | Point | Exon 2, 376C>T, causes R94X, a premature stop codon at 94 | |
| DQB1*03:66N | Point | Exon 2, 278G>A, causes W61X, a premature stop codon at 61 | |
| DQB1*06:26N | Point |
Exon 2, 181-183AGA>TGA, causes R29X, a premature stop at codon 29 | |
| DQB1*06:54N | Point | Exon 2, 279G>A, causes W61X, a premature stop codon at 61 | |
| DQB1*06:75N | Point | Exon 2, 276C>G, causes Y60X, a premature stop codon at 60 | |
| DQB1*06:77N | Point | Exon 2, 253C>T, causes Q53X, a premature stop codon at 53 | |
| DRB1*01:33N | Deletion | Exon 2, 123delG, causes frameshift and premature stop codon at 50 | |
| DRB1*01:39N | Point | Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9 | |
| DRB1*01:40N | Point | Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9 | |
| DRB1*01:52N | Point | Exon 2, 336-338 TAC-TAG, causes Y83X, a premature stop at codon 83 | |
| DRB1*03:67N | Point | Exon 2, 268-270TGG>TGA, causes W61X, a premature stop at codon 61 | |
| DRB1*03:68N | Point | Exon 2, 367-369CGA>TGA, causes R94X, a premature stop at codon 94 | |
| DRB1*04:81N | Deletion |
Exon 2, 296-297delAG, in codon 70, causes frameshift and premature stop at codon 86 | |
| DRB1*04:94N | Point | Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78 | |
| DRB1*04:119N | Point | Exon 2, 334-336TAC>TAG, causes Y83X, a premature stop at codon 83 | |
| DRB1*04:120N | Point | Exon 2, 319-332TAC>TAA, causes Y78X, a premature stop at codon 78 | |
| DRB1*04:142N | Point | Exon 2, 336C>A, causes Y83X, a premature stop at codon 83 | |
| DRB1*04:157N | Point | Exon 2, 321C>A, causes Y78X, a premature stop codon at 78 | |
| DRB1*04:158N | Insertion | Exon 2, 304-305insG, in codon 73, causes a frame shift and premature stop codon at codon 87 | |
| DRB1*07:10N | Deletion |
Exon 2, 175-176delTG, in codon 30, causes frameshift and premature stop at codon 32 | Eiz-Vesper et al. Immunogenetics. 2007 59:507-10 |
| DRB1*12:24N | Point | Exon 2, 268-270TGG>TAG, causes Y61X, a premature stop at codon 61 | |
| DRB1*12:31N | Point | Exon 2, 127-129GAA>TAG, causes E14X, a premature stop at codon 14 | |
| DRB1*13:113N | Deletion | Exon 3, 246delG, causes frameshift and premature stop at codon 99 | |
| DRB1*13:137N | Point | Exon 2 298-300AGG>TAG, causes R71X, a premature stop at codon 71 | |
| DRB1*13:142N | Point | Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop at codon 64 | |
| DRB1*14:92N | Point |
Exon 2, 190-192GAG>TAG, causes E35X, a premature stop at codon 35 | |
| DRB1*14:137N | Insertion | Exon 2, 304-305insG, in codon 73, causes frame shift and premature stop at codon 98 | |
| DRB1*15:17N | Insertion |
Exon 2, 294-295insGA, in codon70, causes frameshift and premature stop at codon 100 | Lebedeva et al. Tissue Antigens. 2005 66:334-5 |
| DRB1*15:50N | Deletion | Exon 2, 303-304delGG, causes frameshift and premature stop codon at 97 | |
| DRB1*15:80N | Point | Exon 2, 301-303delG 304-306delG, in codon 72 and 73, causes frame shift and premature stop at codon 86 | |
| DRB1*16:13N | Point |
Exon 2, 241-243GAG>TAG, causes E52X, a premature stop at codon 52 | Zhao et al. Tissue Antigens. 2008 71:180-2 |
| DRB1*16:21N | Deletion | Exon 2, 170-171delAA, in codon 28, causes frame shift and premature stop codon at codon 32 | |
| DRB3*02:29N | Deletion | Exon 3, 591-595delTGG G, in codons 167-168, causes frameshift and premature stop at codon 191 | |
| DRB4*01:03:01:02N | Point |
Incorrect splicing results in lack of protein sequence | Sutton et al. Immunogenetics. 1990 31:112-7 Naruse et al. Tissue Antigens. 1997 49:152-9 |
| DRB4*02:01N | Deletion |
Exon 2, 155-165delGGGTGC GGTTG, in codons 23-26, causes frameshift and premature stop at codon 29 | Robbins et al. Immunogenetics. 1997 46:104-10 |
| DRB4*03:01N | Undefined |
The allele contains sequence for intron 2 and exon 3, but has no preceding exon sequences | Robbins et al. Immunogenetics. 1997 46:104-10 |
| DRB5*01:08N | Deletion |
Exon 3, 572-590delAAACAGTTC CTCGGAGTGG, in codons 162-168, causes frameshift and possible stop codon after 171 | Voorter et al. Tissue Antigens. 1997 50:326-33 |
| DRB5*01:10N | Deletion |
Exon 2, 326- 327delGA, in codon 80, causes frameshift and premature stop at codon 86 | Balas et al. Tissue Antigens. 2000 55:467-9 |
| MICA*063N | Point | Exon 2, 184-186CAG>TAG, causes Q39X, a premature stop at codon 39 | |
| MICA*064N | Point | Exon 4, 799-801TGG>TGA, causes W244X, a premature stop at codon 244 | |
| MICB*009N | Point |
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | Ando et al. Immunogenetics. 1997 46:499-508 |
| MICB*021N | Deletion |
Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 | Schroeder et al. Tissue Antigens. 2004 64:276-80 |
| TAP1*01:02N | Point |
Exon, 599delG, in codon 200, causes frameshift and premature stop at codon 228 | Furukawa et al. J. Clin. Invest. 1999 103:755-8 |
Alternatively Expressed Alleles
| Allele | Mutation | Description of Mutation | References |
|---|---|---|---|
| A*01:01:38L | Point | Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which results in low expression | |
| A*02:01:01:02L | Point |
Promoter Region, g-101T>C, causes a mutation in the Enhancer B region of the promoter | Balas et al. Hum Immunol. 1994 41:69-73 Perrier et al. Tissue Antigens. 2006 68:442-5 |
| A*02:01:14Q | Point | Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which may may effect expression | |
| A*02:293Q | Point | Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
| A*11:50Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
| A*11:52Q | Deletion | Exon 2, 103-105delTCC, causes deletion of codon 11, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
| A*23:19Q | Point |
Exon 3, 619G>A, in codon 183, mutation occurs at exon boundary, potentially affecting the splice site and affecting expression | |
| A*24:02:01:02L | Point |
Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3 | Magor et al. J. Immunol. 1997 158:5242-50 Laforet et al. Tissue Antigens. 1997 50:340-6 Zanone-Ramseier et al. Transplantation. 1999 67:1336-41 Dunn et al. Tissue Antigens. 2004 63:589-91 |
| A*24:02:03Q | Point | Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which may may effect expression | |
| A*30:14L | Point |
Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
| A*32:11Q | Point |
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | Tang et al. Tissue Antigens. 2006 68:518-20 |
| A*33:03:03Q | Point | Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which may may effect expression | |
| B*13:08Q | Point |
Exon 3, 547-549TAC>TGC, causes Y159C, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
| B*15:218Q | Point | Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
| B*35:65Q | Point |
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | Elsner et al. Immunogenetics. 2006 58:929-31 |
| B*37:16Q | Point |
Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
| B*39:01:01:02L | Deletion |
Promoter region, g-151-152delTC, causes a decrease in promoter activity and low expression of the allele is seen | |
| B*39:38Q | Point |
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | Tang et al. Tissue Antigens. 2006 68:518-20 |
| B*40:133Q | Point |
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
| B*44:02:01:02S | Point |
Intron 4, g1934A>G, causes an incorrect splicing leading to the deletion of exon 5 | Dubois et al. Tissue Antigens. 2004 63:173-80 |
| B*44:138Q | Deletion | Exon 3, 353-355delCCC, causes deletion of codon 94, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
| C*02:25Q | Point |
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
| C*03:22Q | Point |
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | Middleton et al. Tissue Antigens. 2006 67:343-5 |
| C*04:59Q | Point |
Exon 3, 562-564TGC>TAG, causes C161Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
| C*05:51Q | Deletion | Exon 3, 553-567delGAGGGCACGTGTGCGTG, causes deletion of codons 161-165, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
| C*07:121Q | Point |
Exon 3, 562-564TGC>CGC, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
| C*07:150Q | Insertion | Exon 3, 499-500insCCCAGCGCAAGGTCAGATCA, in codon 143, this change may affect the disulphide bond altering conformation of HLA-C and affecting expression | |
| C*12:42Q | Point |
Exon 3, 562-564TGC>TGG, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
| C*15:32Q | Point |
Exon 3, 562-564TGC>GGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
| C*16:16Q | Point |
Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression |
Describing the mutations
The following recommendations are used for describing mutations in nucleotide sequences;
- The numbering of the nucleotides in the reference sequence should remain constant.
- For both gDNA and cDNA the A of the ATG initiator Methionine codon has been denoted nucleotide +1.
- The nucleotide immediately preceding the A of the ATG initiator Methionine codon has been denoted nucleotide -1. Note: that there is no nucleotide 0.
- gDNA numbering is identified by the prefix g. For example; g708G>A refers to position 708 of the gDNA and not 708 of the cDNA sequence.
- Nucleotide substitutions are designated using the nucleotide number, followed by the substitution. For example; 997G>T denotes a substitution of G to T at position 997 of the DNA sequence.
- Deletions are designated by 'del' after the nucleotide number. For example; 997delT denotes the deletion of a T at position 997 of the DNA. For deletions of a number of consecutive bases the mutation should be described as 997-998delTG which denotes a deletion of TG at positions 997 and 998 of the DNA.
- Insertions are designated by 'ins' after the nucleotide numbers bordering the insertion. For example; 997-998insT, represents an insertion of T between bases 997 and 998 of the DNA. In the alignments produced this will be represented by a period (.), but the numbering of the reference sequence will not be altered to include this base. Insertions of multiple bases are designated using the same form, 997-998insTG denotes an insertion of TG between positions 997 and 998 of the DNA.
Mutations in protein sequences follow a similar format;
- The numbering of the amino acids in the reference sequence should remain constant.
- For amino acid-based systems, the start codon of the mature protein is labeled codon 1.
- The codon 5' to this is numbered -1.
- For amino acid nomenclature the reference amino acid is listed first followed by the codon and then the mutation. For example; Y97S represents a substitution of the Tyrosine at codon 97 for a Serine.
- Stop codons are always designated by X. For example; T97X represents a Threonine substituted for a stop codon.
- Deletions are again designated used 'del'. For example; T97del is the deletion of a Threonine at codon 97.
- Insertions again follow the 'ins' convention. For example; T97-98ins represents a Threonine inserted between codons 97 and 98
