Null and Alternatively Expressed Alleles

Assigned as of September 2017

Here are listed all the HLA alleles that have been shown to be either not expressed (Null alleles that have the suffix 'N'), or the alleles that have been shown to be alternatively expressed have the suffix 'L', 'S', 'C', 'A' or 'Q'.

The suffix 'L' is used to indicate an allele that has been shown to have 'Low' cell surface expression when compared to normal levels. The 'S' suffix is used to denote an allele specifying a protein which is expressed as a soluble, 'Secreted' molecule, but is not present on the cell surface. A 'C' suffix is used to indicate an allele product which is present in the 'Cytoplasm', but not on the cell surface. An 'A' suffix is used to indicate an 'Aberrant' expression, specifically where there is some doubt as to whether a protein is expressed at all. A 'Q' suffix is used when the expression of an allele is 'Questionable' given that the mutation seen in the allele has previous¤ly been seen in other aleles and shown to affect normal expression levels.

As of March 2017, there are no alleles which have been named with the 'C' or 'A' suffix.

All numbering and descriptions are based on an alignment to the exon sequence of the standard reference allele for that locus e.g. A*01:01:01:01 for null HLA-A alleles. A full explanation of how the mutations are described is provided after the table.

Null Alleles

Allele Mutation Description of Mutation References
A*01:01:01:02N Deletion
Intron 2, g478-481delGTGA, causes translation of intron 2 sequence and an abnormal truncated peptide 
A*01:04N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196Tissue Antigens (1997) 50:347-50
Transplantation (1999) 67:1336-41
Tissue Antigens (1999) 54:300-2
Tissue Antigens (1999) 54:300-2
Tissue Antigens (1999) 54:300-2
A*01:11N Point
Exon 3, 968G>T, causes alternative splice site at the end of exon 3 which prevents translation into a correct and stable class I molecule expressed on the cell surfaceHum Immunol (2005) 66:912-20
Hum Immunol (2005) 66:912-20
A*01:15N Deletion
Exon 3, 559delC, in codon 163, causes frameshift and premature stop at codon 189Tissue Antigens (2006) 67:61-3
Tissue Antigens (2009) 73:364-72
A*01:16N Insertion
Exon 3, 532-533insG, in codon 154, causes frameshift and premature stop at codon 196 
A*01:18N Point
Exon 2, 214-216CGG>CCG, causes R48P, which may effect the binding of beta-2 microglobulinAmerican Journal of Clinical Pathology (2004) 122:185-92
A*01:22N Deletion
Exon 4, 751delG, in codon 272, causes frameshift and premature stop at codon 272 
A*01:27N Point
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161Human Immunology (2008) 68:913-4
A*01:31N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60Tissue Antigens (2010) 76:149-150
A*01:52:01N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133Tissue Antigens (2014) 83:184-189
A*01:52:02N Point
Exon 3, 471G>A, causes W133X, a premature stop at codon 133 
A*01:53N Point
Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159 
A*01:56N Point
Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217 
A*01:57N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
A*01:87N Deletion
Exon 4, 723delG, in codon 217, causes frameshift and premature stop at codon 272 
A*01:123N Deletion
Exon 3, 610delC, in codon 180, causes frameshift and premature stop at codon 189Human Immunology (2015) 76:30-35
A*01:160N Point
Exon 3, 535C>T, causes Q155X, a premature stop at codon 155 
A*01:162N Point
Exon 2, 286C>T, causes L72X, a premature stop at codon 72 
A*01:178N Point
Exon 3, 564C>A, causes C164X, a premature stop at codon 164 
A*01:179N Point
Exon 3, 580A>T, causes R170X, a premature stop at codon 170 
A*01:186N Point
Exon 2, 166C>T, in codon 32, causes Q32X, a premature stop at codon 32 
A*01:240N Point
Exon 2, 235G>T, causes E55X, a premature stop at codon 55 
A*02:15N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257Immunogenetics (1996) 43:1-5
A*02:32N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141Tissue Antigens (2000) 55:31-6
A*02:43N Insertion
Exon 4, 779-780insC, in codon 236, causes frameshift and premature stop at codon 264 
A*02:53N Point
Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84Tissue Antigens (2002) 59:328-30
A*02:82N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
A*02:83N Point
Exon 4, 829-831GAG>TAG, causes Q253X, a premature stop at codon 253Tissue Antigens (2005) 66:335-7
A*02:88N Point
Exon 3, 418-420GAC>TAG, causes D116X, a premature stop at codon 116 
A*02:94N Deletion
Exon 2, 337delG, in codon 89, causes frameshift and premature stop at codon 126 
A*02:113:01N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60Tissue Antigens (2008) 72:176-7
A*02:113:02N Point
Exon 2, 250-252TGG>TGA, causes W60X, a premature stop at codon 60 
A*02:125N Deletion
Exon 2, 261delG, in codon 63, causes a frameshift and premature stop at codon 67Tissue Antigens (2009) 74:424-428
A*02:222N Point
Exon 3, 451-453AAA>TAA, causes K127X, a premature stop at codon 127 
A*02:223N Point
Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115Tissue Antigens (2014) 83:184-189
A*02:225N Point
Exon 3, 439-441TAC>TAA, causes Y123X, a premature stop at codon 123Tissue Antigens (2014) 83:184-189
A*02:226N Point
Exon 3, 538-540TTG>TAG, causes L156X, a premature stop at codon 156 
A*02:227N Point
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180Tissue Antigens (2013) 81:46-47
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
A*02:250N Deletion
Exon 2, 286-287delCA, in codons 71-72, causes frameshift and premature stop at codon 195 
A*02:284N Point
Exon 3, 391-393TGG>TAG, causes W107X, a premature stop at codon 107 
A*02:301N Deletion
Exon 3, 426delC, in codon 118, causes frameshift and premature stop at codon 118 
A*02:305N Deletion
Exon 4, 814delG, in codon 248, causes frameshift and premature stop at codon 272Tissue Antigens (2012) 79:130-131
A*02:314N Point
Exon 3, 408-411 TAC>TAG, causes Y113X, a premature stop at codon 113 
A*02:321N Point
Exon 2, 244-246GAG>TAG, causes Q58X, premature stop at codon 58 
A*02:350N Point
Exon 2, 337-339GAG>TAG causes E89X, a premature stop at codon 89Tissue Antigens (2014) 83:184-189
A*02:356N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257Tissue Antigens (2013) 42:136-137
A*02:366N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2014) 83:184-189
A*02:373N Point
Exon 3, 514-516GAG>TAG, causes E148X, a premature stop at codon 148 
A*02:395N Point
Exon 2, 268-270AAA>TAA, causes K66X, a premature stop at codon 66Tissue Antigens (2013) 81:451-452
A*02:439N Point
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop codon at 161 
A*02:468:01N Point
Exon 3, 571573TGG>TGA, causes W167X, a premature stop codon at 167 
A*02:468:02N Point
Exon 3, 571-573TGG>TAG, causes W167X, a premature stop codon at 167 
A*02:476N Point
Exon 3, 511-513TGG>TGA, causes W147X, a premature stop codon at 147 
A*02:490N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop codon at 101 
A*02:501N Point
Exon 3, 583-585TAC>TAG, causes Y171X, a premature stop codon at 171 
A*02:506N Insertion
Exon 4, 736-737insG, in codon 222, causes frameshift and premature stop at codon 269 
A*02:514N Point
Exon 2, 247-249TAT>TAG, causes Y57X, a premature stop at codon 59 
A*02:516N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101 
A*02:525N Point
Exon 2, 151-153TAC>TAA, causes Y27X , a premature stop at codon 27 
A*02:540N Point
Exon 3, 367-369TAT>TAG, causes Y99X, a premature stop at codon 99 
A*02:608N Point
Exon 4, 835-837CAG>TAG, causes Q255X, a premature stop at codon 255 
A*02:622N Point
Exon 3, 418-420TAC>TAA, causes D116X, a premature stop at codon 116HLA (2016) 88:38-38
A*02:643N Point
Exon 3, 418-420TAC>TAG, causes Y116X, a premature stop at codon 116 
A*02:675N Deletion
Exon 4, 788delG, in codon 239, causes frameshift and premature stop at codon 164 
A*02:691N Deletion
Exon 4, 740delA, in codon 223, causes a frameshift and premature stop at codon 272 
A*02:696N Point
Exon 3, 549C>A, causes Y159X, a premature stop at codon 159 
A*03:01:01:02N Point
Intron 4, g1846G>A, causes incorrect splicing and premature stop codon 
A*03:03N Deletion
Exon 3, 373-378delTGCGAC, causes deletion of codons 101-102. Codon 101 is necessary for formation of the disulphide bridgeTissue Antigens (1996) 48:187-91
A*03:11N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
A*03:21N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*03:36N Deletion
Exon 2, 264-290delACGGAATATGAAGGCCC, codon 64-73, causes frameshift and premature stop at codon 332 
A*03:68N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87Tissue Antigens (2014) 83:184-189
A*03:69N Point
Exon 3, 538-540CGG>TAG, causes R156X, a premature stop at codon 156Tissue Antigens (2014) 83:184-189
A*03:91N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85Tissue Antigens (2014) 83:184-189
A*03:129N Deletion
Exon 4, 651delC, in codon 193, causes frameshift and premature stop at codon 201 
A*03:161N Point
Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 
A*03:162N Insertion
Exon 4, 664-665insCATG, in codon 198, causes frame shift and premature stop at codon 199Tissue Antigens (2014) 83:53-54
A*03:168N Point
Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27Tissue Antigens (2014) 83:195-196
A*03:178N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
A*03:192N Point
Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147 
A*03:197N Point
Exon 3, 409-411TAC>TAG, causes Y113X, a premature stop at codon 113 
A*03:262N Deletion
Exon 3, 384-393delGGGGCCGGAC, causing frameshift and premature stop at codon 127 
A*03:266N Deletion
Exon 3, 543-544delAG, causes frameshift and premature stop at codon 207 
A*03:269N Point
Exon 3, 375C>A, causes C101X, a premature stop at codon 101 
A*03:275N Point
Exon 2, 225G>A, causes W51X, a premature stop at codon 51 
A*03:279N Deletion
Exon 4, 627delC, in codon 185, causes frameshift and premature stop at codon 189 
A*03:283N Point
Exon 2, 252G>A, causes W60X, a premature stop at codon 60 
A*03:284N Deletion
Exon 2, 204delG, in codon 44, causes frameshift and premature stop at codon 52 
A*11:21N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*11:69N Point
Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217Tissue Antigens (2014) 83:292-293
A*11:78N Deletion
Exon 2, 285-286delAC, causes frameshift and premature stop at codon 73Tissue Antigens (2011) 77:257-258
A*11:99N Deletion
Exon 2, 153delC, in codon 27, causes frameshift and premature stop at codon 27 
A*11:109N Point
Exon 3, 511-514TGG>TGA, causesW147X, a premature stop at codon 147 
A*11:115N Point
Exon 2, 151-153TAC>TAA , causes Y27X, a premature stop at codon 27 
A*11:127N Point
Exon 3, 583-585TAC>TAA , causes Y171X, a premature stop at codon 171Tissue Antigens (2014) 84:510-511
A*11:137:01N Point
Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
A*11:137:02N Point
Exon 3, 426G>A, causes Y118X, a premature stop at codon 118 
A*11:180N Deletion
Exon 2, 307delG, in codon 79, causes frameshift and premature stop at codon 97 
A*11:208N Point
Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51 
A*11:210N Deletion
Exon 4, 642delC, in codon 190, causes frame shift and premature stop at codon 201Tissue Antigens (2015) 85:502-504
A*11:215N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
A*11:238N Point
Exon 2, 199-201CAG>TAG, causes Q43X, a premature stop at codon 43 
A*11:251N Insertion
Exon 2, 204-205insAG, in codon 44, causes frameshift and premature stop at codon 53 
A*23:07N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*23:08N Point
Exon 3, 562-564TGC>TGA, causes c164X, a premature stop at codon 164 
A*23:11N Insertion
Exon 2, 150-151insAGCCCCGCTTCATCGCCGTGGGC, causes frameshift and premature stop at codon 60 
A*23:19N Point
Exon 3, 619G>A, in codon 183, mutation occurs at exon boundary, potentially affecting the splice site. Allele shown to be non-expressed.Human Immunology (2015) 76:286-291
A*23:38N Deletion
Exon 2, 303delC in codon 77, causes frameshift and premature stop at codon 97Tissue Antigens (2012) 79:71-72
A*24:09N Point
Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop at codon 224J Immunol (1997) 158:5242-50
A*24:11N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196J Immunol (1997) 158:5242-50
A*24:36N Deletion
Exon 2, 252-253delGG, in codon 60-61, causes frameshift and premature stop at codon 60Tissue Antigens (2002) 60:184-5
A*24:40N Deletion
Exon 4, 626-627delCC, in codon 185, causes frameshift and premature stop codon 195 
A*24:45N Deletion
Exon 2, 101-102delCA, in codon 10, causes frameshift and premature stop codon 73 
A*24:48N Point
Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154 
A*24:60N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
A*24:83N Point
Exon 4, 697-699TAC>TAA, causes Y209X, a premature stop at codon 209 
A*24:84N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
A*24:86N Insertion
Exon 3, 614-615insGAAGGAGACGCTGCAGC, in codon 181, causes frameshift and premature stop codon 195Tissue Antigens (2009) 73:63-65
A*24:90:01N Point
Exon 3, 418-420GAC>TAG, causes Y116X, a premature stop at codon 116Tissue Antigens (2010) 76:319-324
Tissue Antigens (2010) 76:319-324
A*24:90:02N Point
Exon 3, 420G>A, causes X116X, a premature stop at codon 116 
A*24:132N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101Tissue Antigens (2012) 80:464-465
A*24:155N Deletion
Exon 4, 740delA, causes frameshift and premature stop codon at 272Tissue Antigens (2011) 78:267-270
A*24:158N Deletion
Exon 3, 453-454delCG, causes frameshift and premature stop at codon 195 
A*24:163N Point
Exon 4/5, 895-897GAG>TAG, causesW275X, a premature stop at codon 275Tissue Antigens (2011) 78:267-270
A*24:183N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257Tissue Antigens (2013) 42:136-137
A*24:185N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 
A*24:222N Deletion
Exon 3, 357delC, in codon 96, causes frame shift and premature stop at codon 97 
A*24:232N Insertion
Exon 2, 113-114insTCCCG, in codon 14, causes a frame shift and a premature stop codon at codon 54 
A*24:240N Point
Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84 
A*24:252N Deletion
Exon 2, 282delC, in codon 70, causes a premature stop at codon 108 
A*24:278N Point
Exon 3, 547-549TAC>TAG, causes Y159X, a premature stop at codon 159 
A*24:303N Deletion
Exon 3, 487delG, causes frameshift and premature stop at codon 189 
A*24:312N Point
Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27 
A*24:323N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 
A*24:357N Deletion
Exon 3, 421-431delGCCTACGACGG, deletion of codons 117-119, causes frameshift and premature stop at codon 200 
A*24:359N Deletion
Exon 2, 249-250delTT deletion causing premature stop at codon 73 
A*24:370N Point
Exon 2, 256G>T, causes G62X, a premature stop at codon 62 
A*24:388N Point
Exon 3, 856C>T, causes Q262X, premature stop at codon 262 
A*24:389N Deletion
Exon 2, 253delG, in codon 61, causes frame shift and premature stop codon at codon 67 
A*25:12N Point
Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159Tissue Antigens (2014) 83:184-189
A*25:42N Point
Exon 3, 553G>T, causes E161X, a premature stop at codon 161 
A*26:01:01:03N Point
Intron 4, g1846G>A, causes incorrect splicing and premature stop codonHLA (2016) 88:260-261
A*26:11N Insertion
Exon 3, 516-517insAC, in codon 149, causes frameshift and premature stop at codon 190 
A*26:25N Insertion
Exon 2, 280-281insC, in codon 70, causes frameshift and premature stop at codon 74 
A*26:60N Point
Exon 3, 424-426>TAC>TAG, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
A*26:71N Point
Exon 2, 223-225>TGG>TAG, causes W51X, a premature stop at codon 51Tissue Antigens (2014) 83:184-189
A*26:107N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133Tissue Antigens (2015) 85:502-504
A*26:127N Point
Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154 
A*26:145N Point
Exon 2, 232C>T, causes E54X, a premature stop at codon 54 
A*29:01:01:02N Point
Intron 4, g1846G>T, causes incorrect splicing and premature stop codonTissue Antigens (2002) 59:139-41
A*29:08N Point
Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51 
A*29:78N Point
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 
A*30:27N Point
Exon 3, 535-537GAG>TAG, causes Q155X, a premature stop at codon 155 
A*30:59N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 
A*30:70N Deletion
Exon 2, 208-210delG, in codon 46, causes frame shift and premature stop at codon 52 
A*30:73N Insertion
Exon 3, 516-517insCGGACATGGCGGCTCAGATCACCCAGCGCAAGTGGGAG, in codon 148, causes a frame shift and a premature stop codon at codon 169 
A*30:76N Point
Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 
A*30:78N Deletion
Exon2, 188delA, in codon 39, causes a frame shift and premature stop codon at codon 54 
A*31:01:02:03N Deletion
Intron 1, g176>185delGCGGATCTCA, causes aberrant splicing of intron 1 
A*31:14N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196Tissue Antigens (2006) 68:526-7
A*31:60N Point
Exon 3, 373-375TGC>TGA , causes G101X, a premature stop at codon 101 
A*31:126N Point
Exon 3, 369T>G, causes Y99X, a premature stop at codon 99 
A*32:19N Point
Exon 3, 571-573GGG>TGA, causes G167X, a premature stop at codon 167Tissue Antigens (2009) 74:553-554
A*32:27N Point
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
A*32:45N Point
Exon 3, 508-510AAG>TAG, causes K146X, a premature stop at codon 146Tissue Antigens (2014) 83:184-189
A*32:48N Point
Exon 3, 409-411 TAC>TAG, causes Y113X, a premature stop at codon 113Tissue Antigens (2014) 83:184-189
A*32:56N Deletion
Exon 2, 233delA, in codon 54, causes frameshift and premature stop at codon 67 
A*32:92N Insertion
Exon 3, 617-630insGAGACGCTGCAGCG in codon 181, causes frameshift and premature stop at codon 194 
A*33:73N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*33:74N Point
Exon 4, 802-804TGG>TAG, causes W244X, a premature stop at codon 244 
A*33:80N Point
Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118 
A*33:96N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 
A*33:123N Deletion
Exon 2, 320delG, in codon 83 causes frameshift and premature stop codon 97 
A*33:129N Insertion
Exon 4, 627-628insC, in codon 186 causes frameshift and premature stop at codon 196 
A*34:10N Point
Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 
A*66:27N Point
Exon 2, 327-329TAC>TAA, causes Y85X, a premature stop at codon 85 
A*66:28N Deletion
Exon 4, 627delC, in codon 185, causes a frameshift and premature stop at codon 189 
A*68:11N Deletion
Exon 1, 46delG, in codon 9, causes frameshift and premature stop at codon -6Tissue Antigens (1999) 53:573-5
A*68:18N Insertion
Exon 2, 213-214insCGAGCCAGAGGATGGAGCCG, between codons 47-48, causes frameshift and premature stop at codon 59Tissue Antigens (2002) 60:88-90
A*68:49N Point
Exon 3, 511-513TGG>TAG, causes W147X, a premature stop at codon 147Tissue Antigens (2014) 83:184-189
A*68:59N Point
Exon 3, 511-513TGG>TAG, causes W147X, a premature stop at codon 147Tissue Antigens (2014) 83:184-189
A*68:94N Point
Exon 2, 253-255TGG>TAG , causes W51X, a premature stop at codon 51 
A*68:120N Point
Exon 3, 385-387TCG>TAG, causes S105X, a premature stop at codon 105 
A*68:142N Deletion
Exon 2, 240delG, in codon 56, causes frameshift and premature stop at codon 67 
A*74:12N Deletion
Exon 3, 357-362delCCAGAT, causes deletion of codons 95-97. Protein is not detected at cell surface by pan-class I antibody. 
A*74:14N Point
Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51 
B*07:44N Point
Exon 4, 852T>G, causes alternative splice site at the end of exon 4 which causes translation of intron 4 sequence and an abnormal truncated peptideHLA (2017) 89:230-234
HLA (2017) 89:230-234
B*07:49N Point
Exon 4, 892-894TGG>TAG, causes W274X, a premature stop at codon 274Tissue Antigens (2007) 70:341-3
B*07:67N Deletion
Exon 2, 117delC, in codon 15, causes frameshift and premature stop at codon 34 
B*07:111N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
B*07:135N Point
Exon 3, 553-555GAG>TAG, causes G161X, premature stop at codon 161 
B*07:161N Insertion
Exon 5, 151T, in codon 297, causes a frame shift and premature stop at codon 308 
B*07:167N Point
Exon 3, 502-504 CAG-TAG, causes Q144X, a premature stop at codon 144Tissue Antigens (2014) 83:184-189
B*07:181N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65Tissue Antigens (2014) 83:184-189
B*07:182N Point
Exon 3, 418-420TAC>TAA, causes Y116X, a premature stop at codon 116 
B*07:201N Point
Exon 3, 502-504CAG>TAG, causes Q502X, a premature stop at codon 144 
B*07:231N Point
Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84 
B*07:251N Deletion
Exon 3, 535delC, in codon 155, causes frameshift and premature stop at codon 189 
B*07:272N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at 101 
B*07:285N Deletion
Exon 3, 491delC, in codon 140, causes frameshift and premature stop codon 189 
B*08:08N Deletion
Exon 3, 473delC, in codon 134, causes frameshift and premature stop at codon 189Tissue Antigens (2000) 55:61-4
B*08:19N Point
Exon 4, 724-726CAG>TAG, causes Q218X, a premature stop at codon 218 
B*08:30N Point
Exon 3,424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
B*08:67N Point
Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51 
B*08:72N Point
Exon 2, 295-297CGA>TGA, causes R75X, premature stop at codon 75Tissue Antigens (2014) 83:184-189
B*08:82N Point
Exon 3, 589-591GAG>TAG, causes E173X, a premature stop at codon 173Tissue Antigens (2014) 83:184-189
B*08:86N Point
Exon 3, 571-573TGG>TGA, causes W167X, a premature stop at codon 167Tissue Antigens (2014) 83:184-189
B*08:148N Deletion
Exon 3, 263-266delCACA, in codons 64-65, causes frameshift and premature stop at codon 125 
B*13:07N Deletion
Exon 2, 254-268delACCGGAACACACAGA, codons 61-66, causes no frameshift but exon 2 is 5 amino acids shorter 
B*13:49N Point
Exon 3, 439-441TAC>TAA, causes Y123X, premature stop at codon 123Tissue Antigens (2014) 83:184-189
B*13:56:01N Point
Exon 3, 424-426TAC>TAA, casues Y118X, premature stop at codon 118Tissue Antigens (2014) 83:184-189
B*13:56:02N Point
Exon 3, 424-426TAA>TAG, causes X118X, a premature stop codon at 118 
B*13:63N Insertion
Exon 3, 584-585insA, in codon 171, causes frame shift and premature stop at codon 171Tissue Antigens (2013) 81:459-460
B*13:76N Point
Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop at codon 96 
B*13:103N Deletion
Exon 3, 454G>T, causes E128X, a premature stop at codon 128 
B*14:07N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
B*14:41N Deletion
Exon 3, 523delC, in codon 151, causing frameshift and premature stop at codon 156Tissue Antigens (2015) 86:208-209
B*15:01:01:02N Deletion
Intron 1, g175-184delCGGGTCTCAG, affecting splice site for exon 2Tissue Antigens (1999) 53:244-52
B*15:26N Point
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99Tissue Antigens (1997) 50:351-4
B*15:79N Insertion
Exon 2, 328-329insCA, in codon 86, causes frameshift and premature stop at codon 127 
B*15:94N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
B*15:111N Deletion
Exon 3, 527-536delAGGCGGAGCA, codons 152-155, causes frameshift and premature stop at codon 186 
B*15:149N Deletion
Exon 2, 264-265delAC, in codons 64-65, causes frameshift and premature stop at codon 113Tissue Antigens (2009) 74:447-449
B*15:181N Point
Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
B*15:182N Point
Exon 2, 91-93TAT>TAG, causes Y7X, a premature stop at codon 7Tissue Antigens (2014) 83:184-189
B*15:190N Point
Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147Tissue Antigens (2014) 83:184-189
B*15:209N Point
Exon 3, 469-471TGG>TGA, causes W133X, a premature stop at codon 133Tissue Antigens (2011) 78:267-270
B*15:226N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87HLA (2016) 88:201-203
B*15:246N Deletion
Exon 2, 264-265delAC, in codon 64-65, causes frameshift and premature stop at codon 113 
B*15:258N Point
Exon 3, 583-585TAC>TAA, causes Y171X, a premature stop at codon 171 
B*15:262N Point
Exon 3, 367-369insGACG, in codon 99, causes frameshift and premature stop at codon 115 
B*15:272N Point
Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop codon at 118 
B*15:294N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
B*15:302N Deletion
Exon 4, 723delG, in codon 217, causes frameshift and premature stop at codon 314 
B*15:304N Deletion
Exon 2, 137-147delTCATCGCAGTG, in codons 22-25, causes frameshift and a premature stop at codon 192 
B*15:375N Deletion
Exon 3, 472-478delACCGCGG, codons 134-136, causes frameshift and premature stop at codon 187HLA (2016) 87:104-106
B*15:380N Deletion
Exon 4, 852delT, in codon 261, causes frameshift and premature stop at codon 272 
B*15:400N Deletion
Exon 2, 400-403delCTCC, in codon110, causes frameshift and premature stop at codon 125 
B*18:17N Point
Exon 1, 40-42TCG>TAG, causes W-11X, a premature stop at codon -11Tissue Antigens (2002) 59:341-3
B*18:23N Point
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 
B*18:74N Point
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161Tissue Antigens (2014) 83:184-189
B*18:94N Point
Exon 2, 291-294TAC>TAA, causes Y74X, a premature stop at codon 74 
B*18:138N Deletion
Exon 3, 468-469delCT, in codons 132-133, causes frameshift and premature stop at codon 195 
B*27:59N Point
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72Tissue Antigens (2011) 78:195-202
B*27:64N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
B*27:65N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54Tissue Antigens (2014) 83:184-189
B*27:66N Deletion
Exon 3, 547delT, in codon 159, causes frame shift and a premature stop at codon 246 
B*27:94N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 
B*35:40N Deletion
Exon 4, 807delA, in codon 245, causes frameshift and premature stop at codon 272Tissue Antigens (2002) 59:522-4
B*35:53N Deletion
Exon 3, 473-477delCCGC, in codons 134-135, causes frameshift and premature stop at codon 155 
B*35:129N Point
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72Tissue Antigens (2014) 83:184-189
B*35:130N Point
Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27Tissue Antigens (2014) 83:184-189
B*35:134N Point
Exon 4, 782-784TGG>TGA, causes W224X, a premature stop at 244 
B*35:145N Insertion
Exon 3, 532-533insGCGG, in codon 154 causes a frameshift and premature stop codon at 197 
B*35:165N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at 101 
B*35:173N Point
Exon 2, 222-225TGG>TAG, causes W51X, premature stop at codon 51Tissue Antigens (2014) 83:184-189
B*35:216N Point
Exon 2, 331-333 CAG-TAG, causes Q87X, a premature stop at codon 87 
B*37:03N Point
Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89 
B*37:30N Point
Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133 
B*37:33N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60Tissue Antigens (2014) 83:184-189
B*37:42N Deletion
Exon 2, 213delC, in codon 47, causes a premature stop at codon 52 
B*38:34N Point
Exon 2, 286-288CAG>TAG, causes Q72X, premature stop at codon 72Tissue Antigens (2014) 83:184-189
B*39:25N Deletion
Exon 3, 403-404delGC, in codon 111, causes frameshift and premature stop at codon 113 
B*39:40:01N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
B*39:40:02N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
B*39:87N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 
B*39:95N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 
B*39:97N Insertion
Exon 3, 604-605insGA, in codon 178, causes frameshift and premature stop at codon 190 
B*39:116N Point
Exon 2, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
B*40:22N Point
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58Tissue Antigens (2000) 55:378-80
B*40:118N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
B*40:142N Deletion
Exon 2, 253delG, in codon 60, causes frameshift and premature stop at codon 251 
B*40:144N Point
Exon 4, 826-828GGA>TGA, causes G252X, a premature stop at codon 252Tissue Antigens (2011) 78:267-270
B*40:155:01N Insertion
Exon 3, 593-594insCAGAA, in codon 174, causes frameshift and premature stop at codon 191Tissue Antigens (2011) 78:154-155
B*40:155:02N Insertion
Exon 3, 593-594insCAGAA, in codon 174, causes frameshift and premature stop at codon 191 
B*40:216N Deletion
Exon 3, 385delC, in codon 105, causes frameshift and a premature stop at codon 126 
B*40:256N Deletion
Exon 2, 301-302delAG, in codon 77, causes frameshift and a premature stop at codon 113 
B*40:263N Point
Exon 3, 580582AGA>TGA, causes R170X, a premature stop at codon 170 
B*40:265N Deletion
Exon 2, 189-196delCGCCACGA, causes frameshift and a premature stop at codon 170 
B*40:286N Point
Exon 3, 424-426TAC>TAG, causes Y118X , a premature stop at codon 118 
B*40:291N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 
B*40:337N Point
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 
B*40:338N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 
B*40:345N Insertion
Exon 3, 508insC, in codon 146, causes frameshift and premature stop codon 196 
B*40:361N Point
Exon 2, 331C>T, causes Q87X, premature stop at codon 87 
B*41:45N Insertion
Exon 2, 279-280insGAGACACAGATCTCCAAGACC, causes no frameshift but allele is shown to be non-expressedHLA (2016) 88:50-51
B*44:19N Deletion
Exon 1, 5delT, in codon -23, causes frameshift and a premature stop at codon -6Tissue Antigens (2000) 56:441-5
B*44:23N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141Tissue Antigens (2003) 61:20-48
Eur J Immunogenet (2003) 30:385-6
B*44:52N Deletion
Exon 3, 492-505delTCAGATCACCCAGC, in codons 140-145, causes frameshift and premature stop at codon 191 
B*44:56N Point
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99Tissue Antigens (2009) 73:607-609
B*44:58N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2009) 74:238-240
B*44:61N Point
Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46 
B*44:108N Point
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180Tissue Antigens (2012) 79:50-57
B*44:149N Point
Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop at codon 96Tissue Antigens (2014) 83:184-189
B*44:171N Point
Exon 2, 259-261GAG>TAG, causes E63X, a premature stop at codon 63Tissue Antigens (2014) 83:184-189
B*44:195N Point
Exon 3, 571-573TCG>TAG, causes S167X, a premature stop at codon 167 
B*44:198N Point
Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118 
B*44:217N Point
Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 
B*44:237N Deletion
Exon 2, 286-287delCA, in codon 72, causes frameshift and premature stop at codon 113HLA (2016) 88:126-127
B*44:267N Insertion
Exon 4, 627insC, in codon 185, causes frameshift and premature stop at codon 196 
B*46:07N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164Tissue Antigens (2006) 68:518-20
B*46:15N Point
Exon 4,736-738GAG>TAG, causes E222X, a premature stop at codon 222 
B*46:41N Deletion
Exon 2, 268>280delAGCCGAGGCACA, in codon 66-70, causes a frame shift and premature stop codon at 72 
B*46:55N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop codon at 133 
B*49:19N Point
Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133 
B*51:11N Insertion
Exon 4, 627-628insC, in codon 186 causes frameshift and premature stop at codon 196Tissue Antigens (2001) 57:369-72
B*51:27N Point
Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144Tissue Antigens (2002) 60:262-5
B*51:41N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
B*51:44N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon 65 
B*51:98N Point
Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19Tissue Antigens (2014) 83:184-189
B*51:110N Point
Exon 2, 325-327TAC>TAG, causes Y85X, a premature stop codon 85Tissue Antigens (2014) 83:184-189
B*51:118N Deletion
Exon 2, 264-265delAC, in codons 64-65, causes frameshift and premature stop at codon 113 
B*51:149N Deletion
Exon 3, 611delA, in codon 180, causes frame shift and premature stop codon at codon 189 
B*51:178N Point
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 
B*51:184N Point
Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32 
B*52:49N Point
Exon 3, 601-603GAG>TAG, in codon 177, causes E177X, a premature stop at codon 177 
B*53:48N Point
Exon 3, 426C>A, causes Y118X, a premature stop at codon 118 
B*54:05N Deletion
Exon 2, 212-232delCGCGGGCGCCGTGGATAGAGC, in codons 47-54, causes no frameshift but deletion of 7 amino acids 
B*54:08N Point
Exon 3, 553-554GAG>TAG, causes E161X, a premature stop at codon 161Tissue Antigens (2006) 68:182-182
B*55:55N Point
Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159Tissue Antigens (2014) 83:184-189
B*55:83N Point
Exon 4, 799A>T, causes K243X, a premature stop at codon 243HLA (2017) 89:119-120
B*56:19N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
B*56:28N Point
Exon 2, 247-249TGG>TGA, causes W59X, a premature stop at codon 59 
B*56:38N Point
Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32Tissue Antigens (2014) 83:184-189
B*57:28N Point
Exon 3, 418-420TAC>TAG, causes Y116X, a premature stop at codon 116Int J Immunogenet (2010) 37:299-300
B*57:79N Deletion
Exon 4, 876delG, in codon 268, causes frameshift and premature stop at codon 272 
B*58:10N Deletion
Exon 3, 366delG, in codon 98, causes frameshift and premature stop at codon 126 
B*58:17N Deletion
Exon 3, 311delA, in codon 80, causes frameshift and premature stop at codon 126Tissue Antigens (2009) 73:364-72
B*58:31N Deletion
Exon 4, 872-894delCGAAGCCCCTCACCCTGAGATGG, causes frameshift and premature stop at codon 300 
B*58:39N Point
Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46Tissue Antigens (2014) 83:184-189
B*58:72N Insertion
Exon 3, 508insC, in codon 146, causes frameshift and premature stop at codon 196HLA (2016) 87:54-55
B*59:10N Deletion
Exon 3, 506delG, in codons 145, causes frameshift and premature stop at codon 156 
B*81:04N Point
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58Tissue Antigens (2009) 73:364-72
C*01:37N Point
Exon 3, 361-363TGG>TGA, causes W97X, a premature stop at codon 97 
C*01:56N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 
C*01:69N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2014) 83:184-189
C*01:86N Deletion
Exon 3, 421delG, in codon 117, causes frameshift and premature stop at codon 126 
C*01:89N Point
Exon 4, 841-843TAC>TAG, causes Y257X, a premature stop at codon 257 
C*01:98N Deletion
Exon 2, 285-286delAC, in codons 72-73, causes frameshift and premature stop at codon 73 
C*01:109N Point
Exon 4, 682-684TGG>TAG, in codon 204, causes S204X, a premature stop at codon 204HLA (2017) 89:252-253
C*01:111N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 
C*01:117N Insertion
Exon 2, 203-204insA, in codon 44, causes frameshift and premature stop at codon 74 
C*01:137N Deletion
Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113 
C*01:143N Point
Exon 3, 585C>A, causes Y171X, a premature stop at codon 171 
C*01:145N Point
Exon 3, 420C>A, causes Y116X, a premature stop at codon 116 
C*02:38N Point
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
C*02:52N Point
Exon 2, 151-153TAC>TAA, causes Y27X, premature stop at codon 27Tissue Antigens (2014) 83:184-189
C*02:92N Deletion
Exon 3, 382delG, in codon 104, causes frameshift and premature stop at codon 126 
C*02:105N Insertion
Exon 2, 224-230insTCGCCGT, in codon 51, causes frameshift and premature stop at codon 76 
C*02:121N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*03:20N Point
Exon 1, 19-21CGA>TGA, causes R-18X, a premature stop at codon -18 
C*03:121N Point
Exon 3, 511-513TGG>TGA, causes W147X, premature stop at codon 147 
C*03:189N Point
Exon 2, 151-153TAC>TAG, causes Y27X, a premature stop at codon 27 
C*03:201N Point
Exon 3, 583-585TAC>TAG, causes Y171X, a premature stop at codon 171 
C*03:208N Point
Exon 2, 271-273TAC>TAA, causes Y67X, a premature stop at codon 67 
C*03:224N Point
Exon 4, 727-729TGG>TAG, causes W219X, a premature stop at codon 219 
C*03:229N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 
C*03:265N Point
Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118 
C*03:277N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
C*03:316N Deletion
Exon 2, 286-287delCA, causes frameshift and premature stop at codon 73 
C*03:318N Point
Exon 3, 418-420TAC>TAA, causes Y116X, a premature stop at codon 116 
C*03:323N Point
Exon 2, 280-282CAG>TAG, causes Q70X, a premature stop at codon 70 
C*03:363N Point
Exon 2, 225G>A, causes W51X, a premature stop at codon 51 
C*03:366N Deletion
Exon 4, 668-678delCCACCCTGAGG, in codons 199-202, causes frameshift and premature stop at codon 225 
C*04:09N Deletion
Exon 7, 1095delA, in codon 341, causes frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 32 amino acidsTissue Antigens (2002) 59:95-100
Tissue Antigens (2002) 59:95-100
Human Immunology (2013) 74:325-329
C*04:88N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87Tissue Antigens (2014) 83:184-189
C*04:93N Point
Exon 3, 373-375TGC>TGA, causes C101X, premature stop at codon 101Tissue Antigens (2014) 83:184-189
C*04:95N Point
Exon 3, 547-549TAC>TAA, causes W159X, premature stop at codon 159Tissue Antigens (2014) 83:184-189
C*04:105N Point
Exon 2, 247-249TAT>TAG, causes Y59X, a premature stop at codon 59Tissue Antigens (2014) 83:184-189
C*04:115N Point
Exon 2, 49-51GAG>TAG, causes A49X, a premature stop at codon 49Tissue Antigens (2014) 83:184-189
C*04:123N Point
Exon 2, 115-117CAG>TAG, causes Q115X, a premature stop at codon 115 
C*04:170N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*04:173N Point
Exon 2, 268-270AAG>TAG, causes K66X, a premature stop at codon 66 
C*04:191N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 
C*04:203N Point
Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147 
C*04:205N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 
C*04:215N Point
Exon 2, 271-273TAC>TAG, causes Y67X, a premature stop at codon 67 
C*04:217N Deletion
Exon 2, 208delG, in codon 46 causes frameshift and premature stop at codon 76 
C*04:225N Point
Exon 2, 265-267CAG>TAG, causes E65X, a premature stop at codon 65 
C*04:233N Point
Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 
C*04:234N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 
C*04:236N Deletion
Exon 2, 218delA, in codon 49 causes frameshift and premature stop at codon 76 
C*04:253N Point
Exon 3, 532-534GAG>TAG causes R154X, a premature stop at codon 154 
C*04:255N Insertion
Exon 2, 194-195insC, in codon 41, causes frameshift and premature stop at codon 74 
C*04:279N Point
Exon 2, 295C>T, causes R75X, a premature stop at codon 75 
C*05:07N Deletion
Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113 
C*05:48N Point
Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32Tissue Antigens (2014) 83:184-189
C*05:91N Point
Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89 
C*05:92N Point
Exon 2, 175-177CAG>TAG, causes Q35X, a premature stop at codon 35 
C*05:99N Deletion
Exon 3, 384delG, in codon 104, causes frameshift and premature stop at codon 126Tissue Antigens (2014) 84:420-421
C*05:113N Deletion
Exon 2, 93-34delTT, in codons 7-8, causes frameshift and premature stop at codon 74 
C*05:128N Deletion
Exon 3, 461-474delTGCGCTCCTGGACC, in codons 130-134, causes frameshift and premature stop at codon 147 
C*05:153N Point
Exon 1, 613G>T, causes E-4X, premature stop at codon -4 
C*05:154N Point
Exon 3, 514G>T, causes E148X, premature stop at codon 148 
C*06:16N Deletion
Exon 3, 499-500delAC, in codon 143, causes a frameshift and premature stop at codon 151Tissue Antigens (2007) 70:441-2
C*06:46N Point
Exon 4, 742-744CAA>TAA, causes Q224X, a premature stop at codon 224 
C*06:49N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101Tissue Antigens (2014) 83:184-189
C*06:79N Point
Exon 3, 538-540TGG>TGA, causes R156X, a premature stop at codon 156 
C*06:116N Deletion
Exon 3, 615-619delCGCGG, in codon 181, causes a premature stop at codon 198 
C*06:128N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 
C*06:134N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65 
C*06:152N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 
C*06:171N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*06:175N Point
Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147 
C*07:32N Insertion
Exon 3, 560-561insCGCAGAT, in codon 163, causes frameshift and premature stop at codon 198 
C*07:33N Deletion
Exon 2, 92delA, in codon 7, causes frameshift and premature stop at codon 76Tissue Antigens (2008) 71:560-3
C*07:55N Point
Exon 3, 409-411TAT>TAG, causes Y113X, a premature stop at codon 113Tissue Antigens (2012) 79:139-139
C*07:61N Point
Exon 2, 280-282CAG>TAG, causes Q70X, a premature stop at codon 70 
C*07:98N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141Tissue Antigens (2014) 83:184-189
C*07:104N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
C*07:152N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2014) 83:184-189
C*07:164N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*07:191N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
C*07:198N Point
Exon 2, 202-204AGA>TGA, causes R44X, a premature stop at codon 44 
C*07:227N Point
Exon 2, 124-126GGA>TGA, causes 18GX, a premature stop at codon 18 
C*07:264N Point
Exon 3, 535-537CAG>TAG, causes Q155X, a premature stop at codon 155 
C*07:329N Point
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 
C*07:347N Deletion
Exon 3, 537delG, in codon 155, causes frameshift and premature stop at codon 156 
C*07:350N Insertion
Exon 4, 706-707insG, in codon 212, causes a frame shift 
C*07:393N Deletion
Exon 3, 564delC, in codon 158, causes frameshift and premature stop at codon 189Tissue Antigens (2015) 85:511-512
C*07:437N Deletion
Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop at codon 73 
C*07:451N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*07:452N Point
Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46 
C*07:476N Point
Exon 2, 265-267CAG>TAG, causes Q85X, a premature stop at codon 85 
C*07:483N Point
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161 
C*07:484N Point
Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 
C*07:491:01N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 
C*07:491:02N Point
Exon 3, 469-471TAG>TGA, causes X133X, a premature stop at codon 133 
C*07:507N Point
Exon 2, 259-261GAG>TAG, causes E63X, a premature stop at codon 63 
C*07:551N Deletion
Exon 3, 596-606delGGAAGGAGACG causing frameshift and premature stop at codon 195 
C*07:593N Point
Exon 4, 893G>A, causes W148X, premature stop at codon 148 
C*07:600N Point
Exon 2, 224G>A, causes W51X, a premature stop at codon 51 
C*08:26N Point
Exon 3, 439-441TAC>TAG, causes Y123X, a premature stop codon at 123Tissue Antigens (2011) 77:54-61
C*08:36N Insertion
Exon 3, 439-441TAC>TAG, causes Y123X, a premature stop at codon 123 
C*08:52N Deletion
Exon 4, 678delG, in codon 202, causes frameshift and premature stop at codon 215 
C*08:55N Point
Exon 2, 175-178CGG>TAG, causes R35X, a premature stop at codon 35 
C*08:88N Deletion
Exon 3, 421-427delGCCTACG, in codon 117-119, causes a frame shift and premature stop at codon 124 
C*08:89N Insertion
Exon 2, 133>134InsC, in codon 21, causes a frame shift and premature stop at codon 74 
C*08:121N Deletion
Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop at codon 73HLA (2016) 87:55-56
C*08:127N Insertion
Exon 3, 434-435insG, in codon 121, causes frameshift and premature stop at codon 128 
C*08:129N Insertion
Exon 3, 437-438insA, in codon 121, causes frameshift and premature stop at codon 128 
C*08:130N Point
Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46 
C*12:39N Point
Exon 2, 250-252TGG>TGA, causes W60X, a premature stop at codon 60Tissue Antigens (2014) 83:184-189
C*12:46N Point
Exon 3, 424-429TAC>TAG, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
C*12:80N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 
C*12:84N Insertion
Exon 2, 202-204insA, in codon 44, causes frame shift and premature stop at codon 75 
C*12:104N Point
Exon 3, 502-504CAG-TAG, causes Q144X, a premature stop at codon 144 
C*12:105N Point
Exon 3, 514-516GAG>TAG, causes E148X, a premature stop at codon 148 
C*12:148N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65 
C*14:07N Point
Exon 3, 583-585TAC-TAA, causes Y171X, a premature stop at codon 171 
C*14:21N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
C*14:35N Point
Exon 3 361-363TGG>TGA, causes W97X, a premature stop at codon 97 
C*14:47N Point
Exon 3, 469-471TGG>TGA, causes W133X, a premature stop at codon 133 
C*15:02:01:08N Point
Intron 2, g431A>T, causes an incorrect splicing leading to the deletion of part of exon 3 
C*15:92N Point
Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop codon at 96 
C*15:95N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon in 65 
C*15:115N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 
C*15:122N Point
Exon 2, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 
C*15:145N Point
Exon 3, 589G>T, causes E173X, premature stop at codon 173 
C*16:30N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87Tissue Antigens (2014) 83:184-189
C*16:77N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*16:89N Point
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 
C*17:27N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
C*18:07N Point
Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 
DOA*01:04N Deletion
Exon 2, 108delC, in codon 11, causes frameshift and premature stop at codon 37Tissue Antigens (2005) 66:242-5
DPB1*04:01:01:24N Point
Intron 2, g5163G>T, affecting splicing site for exon 2 
DPB1*61:01N Point
Exon 2, 286-288GAG>TAG, causes E67X, a premature stop at codon 67Tissue Antigens (1996) 47:293-9
DPB1*64:01N Point
Exon 2, 106-108TAC>TAA, causes Y7X, a premature stop at codon 7Tissue Antigens (1997) 49:262-6
DPB1*120:01N Point
Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10 
DPB1*154:01N Point
Exon 2, 271-273CAG>TAG, causes Q62X, a premature stop at codon 62 
DPB1*159:01N Point
Exon 2, 361-363CGA>TGA, causes R92X, a premature stop at codon 92 
DPB1*161:01N Point
Exon 2, 340-342GAG>TAG, causes E85X, a premature stop at codon 85 
DPB1*216:01N Point
Exon 2, 319-321AGA>TGA, causes R78X, a premature stop at codon 78 
DPB1*218:01N Point
Exon 2, 151-153CAG>TAG, causes Q22X, a premature stop at codon 22 
DPB1*328:01N Point
Exon 2, 361-363CGA>TGA, causes R92X, a premature stop at codon 92 
DPB1*357:01N Point
Exon 2, 328-330TAC>TAG, causes Y81X, a premature stop at codon 81 
DPB1*382:01N Point
Exon 2, 166-168AGA>TGA, causes R27X, a premature stop at codon 27 
DPB1*401:01N Point
Exon 2, 328-330TAC>TAG, causes Y81X, a premature stop at codon 81 
DPB1*403:01N Point
Exon 2, 262-264TGG>TGA, causes W59X, a premature stop at codon 59 
DPB1*450:01N Point
Exon 2, 124-126CAG>TAG, causes Q13X, a premature stop at codon 13 
DPB1*455:01N Point
Exon 2, 355-357CAG>TAG, causes Q90X, a premature stop at codon 90 
DPB1*507:01N Point
Exon 2, 340-342GAG>TAG, causes E85X, a premature stop at codon 85 
DPB1*551:01N Point
Exon 2, 262-264TGG>TGA, causes W59X, a premature stop at codon 59 
DPB1*570:01N Point
Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10 
DPB1*598:01N Point
Exon 2, 151-153CAG>TAG, causes Q22X, a premature stop at codon 22 
DPB1*657:01N Point
Exon 2, 166C>A, causes R27X, a premature stop at codon 27 
DPB1*661:01N Point
Exon 2, 166C>A, causes R27X, a premature stop at codon 27 
DQA1*01:15N Point
Exon 2, 212G>A, causes W48X, a premature stop at codon 48 
DQA1*01:16N Deletion
Exon 2, 236delG, in codon 56, causes frameshift and premature stop at codon 63 
DQA1*04:03N Point
Exon 2, 236-238AAA>TAA, causes Q53X, a premature stop at codon 53Tissue Antigens (2004) 63:609-11
DQB1*02:18N Point
Exon 2, 277-279TGG>TGA, causes W61X, a premature stop at codon 61Tissue Antigens (2014) 84:497-502
DQB1*02:20N Point
Exon 2, 376-378CGA>TGA, causes R94X, a premature stop at codon 94Tissue Antigens (2014) 84:497-502
DQB1*02:58N Point
Exon 2, 199-201GAA>TAA, causes E35X, a premature stop at codon 35 
DQB1*02:67N Point
Exon 2, 142-144TAC>TAG, causes Y16X, a premature stop at codon 16 
DQB1*02:96N Point
Exon 3, 449C>A, causes S118X, premature stop at codon 118 
DQB1*03:66N Point
Exon 2, 277-279TGG>TAG, causes W61X, a premature stop at codon 61Tissue Antigens (2014) 84:497-502
DQB1*03:84N Point
Exon 2, 622-624GAG>TAG, causes E176X, a premature stop at codon 176 
DQB1*03:90N Deletion
Exon 2, 240delG, in codon 48, causes a premature stop codon at 50 
DQB1*03:95N Deletion
Exon 2, 183delG, in codon 29, causes a premature stop codon at 67 
DQB1*03:118N Point
Exon 2, 205-207TAC>TAA, causes Y37X, a premature stop at codon 37 
DQB1*03:213N Point
Exon 2, 286-288CAG>TAG, causes Q64X, a premature stop at codon 64 
DQB1*03:237N Point
Exon 2, 205-207TAC>TAA causes Y37X, a premature stop at codon 37 
DQB1*03:269N Point
Exon 2, 196C>T, causes R34X, premature stop at codon 34 
DQB1*04:25N Point
Exon 2, 271-273GAG>TAG, causes E59X, a premature stop at codon 59 
DQB1*04:36N Point
Exon 2, 376-378CGA>TGA, causes R94X, a premature stop at codon 94 
DQB1*04:41N Point
Exon 3, 465T>G, causes Y123X, a premature stop at codon 123 
DQB1*05:41N Point
Exon 3, 448-450TCG>TAG, causes S118X, a premature stop at codon 118 
DQB1*05:90N Point
Exon 3, 448-450TCG>TAG, causes S118X, a premature stop at codon 118 
DQB1*05:110N Point
Exon 2, 196-198CGA>TGA, causes R34X, a premature stop at codon 34 
DQB1*05:128N Point
Exon 2, 370-372CAG>TAG causes Q92X, a premature stop at codon 92 
DQB1*06:26N Point
Exon 2, 181-183AGA>TGA, causes R29X, a premature stop at codon 29 
DQB1*06:54N Point
Exon 2, 277-279TGG>TGA, causes W61X, a premature stop at codon 61Tissue Antigens (2014) 84:497-502
DQB1*06:75N Point
Exon 2, 274-276TAC>TAG, causes Y60X, a premature stop at codon 60Tissue Antigens (2014) 84:497-502
DQB1*06:77N Point
Exon 2, 253-255CAG>TAG, causes Q53X, a premature stop at codon 53 
DQB1*06:102N Point
Exon 3, 487-489TGG>TAG, causes W131X, a premature stop at codon 131 
DQB1*06:112N Point
Exon 2, 124-126CAG>TAG, causes Q10X, a premature stop at codon 10 
DQB1*06:144N Point
Exon 2, 205-207TAC>TAA, causes Y37X, a premature stop at codon 37 
DQB1*06:158N Point
Exon 2, 196-198CGA>TGA causes R34X, a premature stop at codon 34 
DQB1*06:179N Point
Exon 2, 196-198CGA>TGA, causes R34X, a premature stop at codon 34 
DQB1*06:193N Point
Exon 2, 277-279TGG>TAG, causes Y61X, a premature stop at codon 61 
DQB1*06:216N Point
Exon 2, 655G>T, causes E187X, a premature stop at codon 187 
DRB1*01:33N Deletion
Exon 2, 123delG, causes frameshift and premature stop codon at 50Tissue Antigens (2011) 78:463-464
DRB1*01:39N Point
Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9Tissue Antigens (2014) 84:497-502
DRB1*01:40N Point
Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9 
DRB1*01:52N Point
Exon 2, 336-338TAC>TAG, causes Y83X, a premature stop at codon 83 
DRB1*01:62N Point
Exon 2, 268-270TGG>TGA, causes W61X, a premature stop at codon 61 
DRB1*01:68N Point
Exon 2, 295-297CAG>TAG, causes Q70X, a premature stop at codon 70 
DRB1*03:67N Point
Exon 2, 268-270TGG>TGA, causes W61X, a premature stop at codon 61Tissue Antigens (2014) 84:497-502
DRB1*03:68N Point
Exon 2, 367-369CGA>TGA, causes R94X, a premature stop at codon 94 
DRB1*04:81N Deletion
Exon 2, 296-297delAG, in codon 70, causes frameshift and premature stop at codon 86 
DRB1*04:94:01N Point
Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78Tissue Antigens (2011) 78:226-227
DRB1*04:119N Point
Exon 2, 334-336TAC>TAG, causes Y83X, a premature stop at codon 83Tissue Antigens (2014) 84:497-502
DRB1*04:120N Point
Exon 2, 319-332TAC>TAA, causes Y78X, a premature stop at codon 78Tissue Antigens (2014) 84:497-502
DRB1*04:142N Point
Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83Tissue Antigens (2014) 84:497-502
DRB1*04:157N Point
Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78 
DRB1*04:158N Insertion
Exon 2, 304-305insG, in codon 73, causes a frame shift and premature stop codon at codon 87 
DRB1*04:178N Insertion
Exon 2, 318-319insC, in codon 87, causes frame shift and premature stop at codon at 87 Tissue Antigens () :-
DRB1*04:186N Point
Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78  
DRB1*04:212N Point
Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78 
DRB1*04:214N Point
Exon 2, 187-189CAA>TAA, causes Q34X, a premature stop at codon 34 
DRB1*07:10N Deletion
Exon 2, 175-176delTG, in codon 30, causes frameshift and premature stop at codon 32Immunogenetics (2007) 59:507-10
DRB1*07:26N Insertion
Exon 2, 172-173insA, in codon 29, causes a frame shift and a premature stop at codon 33 
DRB1*07:58N Point
Exon 2, 160-162CAG>TAG, causes R25X, a premature stop at codon 25 
DRB1*07:68N Deletion
Exon 2, 278delA, in codon 64, causes frameshift and premature stop at codon 99 
DRB1*08:60N Deletion
Exon 2, 341delT, in codon 85, causes frameshift and premature stop at codon 99  
DRB1*08:78N Point
Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop at codon 64 
DRB1*11:169N Deletion
Exon 2, 326-327delGA, in codon 80, causes frameshift and premature stop at codon 86 
DRB1*11:217N Point
Exon 2, 194G>T, causes E36X, premature stop at codon 36 
DRB1*12:24N Point
Exon 2, 268-270TGG>TAG, causes Y61X, a premature stop at codon 61Tissue Antigens (2011) 78:45-48
DRB1*12:31N Point
Exon 2, 127-129GAA>TAG, causes E14X, a premature stop at codon 14 
DRB1*12:60N Deletion
Exon 2, 157-157delG, in codon 24, causes frameshift and premature stop at codon 50HLA (2017) 89:65-66
DRB1*13:113N Deletion
Exon 2, 246delG, causes frameshift and premature stop at codon 99 
DRB1*13:137N Point
Exon 2 298-300AGG>TAG, causes R71X, a premature stop at codon 71Tissue Antigens (2014) 84:497-502
DRB1*13:142N Point
Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop at codon 64Tissue Antigens (2014) 84:497-502
DRB1*13:185N Point
Exon 2, 223-225GAG>TAG, causes E46X, a premature stop at codon 46 
DRB1*13:200N Point
Exon 2, 112-114GAG>TAG, causes W9X, a premature stop at codon 9 
DRB1*14:92N Point
Exon 2, 190-192GAG>TAG, causes E35X, a premature stop at codon 35 
DRB1*14:137N Insertion
Exon 2, 304-305insG, in codon 73, causes frame shift and premature stop at codon 98Tissue Antigens (2013) 82:201-202
DRB1*14:152N Insertion
Exon 2, 303-304insG, in codon 73, causes a frame shift and a premature stop at codon 106 
DRB1*14:166N Point
Exon 2, 173-174insA, in codon 29, causes frameshift and premature stop at codon 33 
DRB1*14:188N Point
Exon 2, 113C>T, causes Q16X, premature stop at codon 116 
DRB1*15:17N Insertion
Exon 2, 294-295insGA, in codon70, causes frameshift and premature stop at codon 100Tissue Antigens (2005) 66:334-5
DRB1*15:50N Deletion
Exon 2, 303-304delGG, causes frameshift and premature stop at codon 97 
DRB1*15:80N Point
Exon 2, 303-304delGG, in codon 71, causes frameshift and premature stop at codon 86 
DRB1*15:113N Point
Exon 2, 115-117CAG>TAG, causes Q10X, a premature stop at codon 10 
DRB1*15:115N Deletion
Exon 2, 295-296delGA, in codon 70, causes frameshift and premature stop at codon 86Tissue Antigens (2015) 86:69-70
DRB1*15:129N Deletion
Exon 2, 303-304delGG, in codons 72-73, causes frameshift and premature stop at codon 97 
DRB1*15:134N Deletion
Exon 2, 142-143delTG, in codon 19, causes frameshift and premature stop at codon 32 
DRB1*15:137N Point
Exon 2, 187-189CAG>TAG, causes Q34X, a premature stop at codon 34 
DRB1*15:138N Insertion
Exon 2, 158-158insG, in codon 24, causes frameshift and premature stop at codon 33 
DRB1*16:13N Point
Exon 2, 241-243GAG>TAG, causes E52X, a premature stop at codon 52Tissue Antigens (2008) 71:180-2
DRB1*16:21N Deletion
Exon 2, 170-171delAA, in codon 28, causes frameshift and premature stop at codon 32 
DRB1*16:41N Point
Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83 
DRB3*01:26N Point
Exon 2, 175-177TAC>TAA, causes C30X, a premature stop at codon 30 
DRB3*01:40N Point
Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83 
DRB3*02:29N Deletion
Exon 3, 588-592delTGGAG, in codons 167-169, causes frameshift and premature stop at codon 191 
DRB3*02:55N Point
Exon 2, 334-336TAC>TAG, causes Y83X, a premature stop at codon 83 
DRB4*01:03:01:02N Point
Incorrect splicing results in lack of protein sequenceImmunogenetics (1990) 31:112-7
Tissue Antigens (1997) 49:152-9
Immunogenetics (1990) 31:112-7
DRB4*01:16N Point
Exon 2, 265-267TAC>TAG, causes Y60X, a premature stop at codon 60 
DRB4*01:38N Point
Exon 2, 361-363CAG>TAG causes Q92X, a premature stop at codon 92 
DRB4*01:54N Point
Exon 2, 367C>T, causes R94X, premature stop at codon 94 
DRB4*01:56N Point
Exon 2, 277C>T, causes Q64X, premature stop at codon 64 
DRB4*02:01N Deletion
Exon 2, 155-165delGGGTGCGGTTG, in codons 23-26, causes frameshift and premature stop at codon 29Immunogenetics (1997) 46:104-10
DRB4*03:01N Deletion
The allele contains sequence for intron 2 and exon 3, but has no preceding exon sequencesImmunogenetics (1997) 46:104-10
DRB5*01:08N Deletion
Exon 3, 572-590delAAACAGTTCCTCGGAGTGG, in codons 162-168, causes frameshift and possible stop codon after 171Tissue Antigens (1997) 50:326-33
DRB5*01:10N Deletion
Exon 2, 326- 327delGA, in codon 80, causes frameshift and premature stop at codon 86Tissue Antigens (2000) 55:467-9
DRB5*01:27N Point
Exon 2, 336C>G, causes Y83X, a premature stop at codon 83 
E*01:08N Point
Exon 2, 313-315TAC>TAG, causes Y84X, a premature stop at codon 84HLA (2017) 89:143-149
G*01:05N Deletion
Exon 3, 460delC, in codon 130, causes frameshift and premature stop at codon 171Immunogenetics (2006) 58:241-51
Immunogenetics (1997) 45:464-5
G*01:13N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54Tissue Antigens (2008) 72:491-505
MICA*063N Point
Exon 2, 184-186CAG>TAG, causes Q39X, a premature stop at codon 39Tissue Antigens (2011) 78:297-298
MICA*064N Point
Exon 4, 799-801TGG>TGA, causes W244X, a premature stop at codon 244Tissue Antigens (2012) 79:313-314
MICB*009N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170Immunogenetics (1997) 46:499-508
MICB*021N Deletion
Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89Tissue Antigens (2004) 64:276-80
TAP1*01:02N Deletion
Exon, 599delG, in codon 200, causes frameshift and premature stop at codon 228J Clin Invest (1999) 103:755-8

Alternatively Expressed Alleles

Allele Mutation Description of Mutation References
A*01:01:38L Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which results in low expression 
A*01:147Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*01:208Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*01:228Q Deletion
Exon 3, 388-393delGACGGG, causes deletion of codons 106-107 
A*02:01:01:02L Point
Promoter Region, g-101T>C, causes a mutation in the Enhancer B region of the promoterHum Immunol (1994) 41:69-73
Tissue Antigens (2006) 68:442-5
A*02:01:14Q Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expression 
A*02:293Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionTissue Antigens (2011) 78:267-270
A*02:440Q Point
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:500Q Point
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:605Q Point
Exon 3, 373-375TGC>TGG, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:618Q Deletion
Exon 3, 520-531delGCCCATGTGGCG, a deletion of codons 150-153, which may affect expression 
A*02:672Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*03:234Q Deletion
Exon 3, 520-531delGAGGCGGCCCAT, a deletion of codons 150-153, which may affect expression 
A*11:50Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*11:52Q Deletion
Exon 2, 103-105delTCC, causes deletion of codon 11, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionTissue Antigens (2011) 78:195-202
A*11:170Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*11:182Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*11:235Q Deletion
Exon 2, 118-123delGGCCGC, causes deletion of codons 16-17, which may affect expressionHLA (2016) 87:456-458
A*11:256Q Deletion
Exon 3, 409-417delTACCGGCAG, causes deletion of codons 113-115HLA (2017) 89:302-304
A*24:02:01:02L Point
Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3Tissue Antigens (2004) 63:589-91
J Immunol (1997) 158:5242-50
Tissue Antigens (1997) 50:340-6
Transplantation (1999) 67:1336-41
A*24:02:03Q Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expressionTissue Antigens (2003) 61:325-9
A*24:294Q Deletion
Exon 2, 325-327delTAC, a deletion of codon 85, which may affect expression 
A*30:14L Point
Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*30:101Q Point
Exon 3, 373-375TGC>TGG, causes C101R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*32:11Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionTissue Antigens (2006) 68:518-20
A*32:101Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*33:03:03Q Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expressionTissue Antigens (2009) 74:432-434
A*66:26Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*68:148Q Point
Exon 3, 562-564TGC>AGC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*68:159Q Deletion
Exon 2, 328-330delAAC, causes deletion of codon 86 
B*15:218Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2014) 83:184-189
B*15:245Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*15:321Q Deletion
Exon 4, 742-753delCAAACTCAGGAC, a deletion of codons 224-227, which may affect expression 
B*15:377Q Deletion
Exon 2, 325-327delTAC, a deletion of codon 85, which may affect expression 
B*27:05:02:04Q Point
Intron 1, g716G>A, affecting splice site for exon 3, which may affect expression 
B*35:65Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionImmunogenetics (2006) 58:929-31
B*35:333Q Point
Exon 3, 563G>A, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*37:16Q Point
Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2014) 83:184-189
B*38:55Q Point
Exon 3, 373-375TGC>CGC, causes C101R, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionHuman Immunology () :-
B*38:68Q Deletion
Exon 4, 760-768delCTTGTGGAG, causes deletion of codons 229-231, which may affect expression 
B*39:01:01:02L Deletion
Promoter region, g-151-152delTC, causes a decrease in promoter activity and low expression of the allele is seen 
B*39:38Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2006) 68:518-20
HLA (2017) 89:159-162
B*40:133Q Point
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2014) 83:184-189
B*44:02:01:02S Point
Intron 4, g1934A>G, causes an incorrect splicing leading to the deletion of exon 5Tissue Antigens (2004) 63:173-80
B*44:138Q Deletion
Exon 3, 353-355delCCC, causes deletion of codon 94, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*44:160Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*46:51Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*51:173Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
C*01:121Q Point
Exon 3, 562-564TGC>AGC, causes C164S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*02:25Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
C*02:67Q Point
Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
C*03:22Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2006) 67:343-5
C*03:169Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
C*03:244Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
C*04:59Q Point
Exon 3, 562-564TGC>TAG, causes C161Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
C*05:51Q Deletion
Exon 3, 553-567delGAGGGCACGTGTGCGTG, causes deletion of codons 161-165, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*06:74Q Point
Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
C*06:200Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*07:01:01:14Q Point
Intron 1, g203C>G, affecting splice site for exon 2, which may affect expression 
C*07:121Q Point
Exon 3, 562-564TGC>CGC, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
C*07:150Q Insertion
Exon 3, 499-500insCCCAGCGCAAGGTCAGATCA, in codon 143, this change may affect the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2012) 79:50-57
C*07:235Q Point
Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*07:494Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*07:513Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*07:582Q Point
Exon 3, 373-375TGC>GGC, in codon 101, causes C101G, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*08:70Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
C*08:141Q Point
Exon 3, 375C>G, causes C101W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*12:42Q Point
Exon 3, 562-564TGC>TGG, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
C*12:155Q Point
Exon 3, 373-375TGC>TGG, in codon 101, causes C101W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*15:32Q Point
Exon 3, 562-564TGC>GGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*15:84Q Deletion
Exon 3, 550-555delCTGGAG, in codons 160-161, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*15:96Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2015) 86:302-303
C*15:105Q Deletion
Exon 3, 399-401delCCT, a deletion of codon 110, which may affect expression 
C*16:16Q Point
Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
DQA1*01:07Q Point
Exon 2, 304-306CGC>TGC, causes R79C, which may affect expression.Hum Immunol (2005) 66:1248-53
Tissue Antigens (1997) 50:334-9
Tissue Antigens (2014) 83:49-51
Tissue Antigens (2015) 86:413-418
DQB1*02:53Q Deletion
Exon 2, 289-291delAAG, a deletion of codon 65, which may affect expression 
DQB1*03:91Q Insertion
Exon 2, 594-595insACTCCCCA, in codon 167, no internal stop codon 
DQB1*03:99Q Deletion
Exon 2, 189-191delCTA, in codon 31>32, no internal stop codon 
DQB1*03:197Q Deletion
Exon 2, 277-282delTGGAAC, a deletion of codons 61-62, which may affect expression 
DQB1*05:87Q Deletion
Exon 3, 508-510delGAG, a deletion of codon 138, which may affect expression 
DQB1*05:132Q Deletion
Exon 3, 508-510delGAG, causes deletion of codon 138 
DRB3*02:61Q Deletion
Exon 2, 193-195delGAG, causes deletion of codon 36 

Describing the mutations

The following recommendations are used for describing mutations in nucleotide sequences:

Mutations in protein sequences follow a similar format: