Null and Alternatively Expressed Alleles
Assigned July 2010
We list here all HLA alleles which have been shown to either not to be expressed, Null alleles, that have the suffix 'N' and those alleles which have been shown to be alternatively expressed have the suffix 'L', 'S', 'C', 'A' or 'Q'.
The suffix 'L' is used to indicate an allele which has been shown to have 'Low' cell surface expression when compared to normal levels. The 'S' suffix is used to denote an allele specifying a protein which is expressed as a soluble 'Secreted' molecule but is not present on the cell surface. A 'C' suffix to indicate an allele product which is present in the 'Cytoplasm' but not on the cell surface. An 'A' suffix to indicate 'Aberrant' expression where there is some doubt as to whether a protein is expressed. A 'Q' suffix when the expression of an allele is 'Questionable' given that the mutation seen in the allele has previousÏly been shown to effect normal expression levels.
As of July 2010 no alleles have been named which use the 'C' or 'A' suffix.
All numbering is based on alignment to the exon sequence of the standard reference allele for that locus e.g.; A*01:01:01:01 for null HLA-A alleles. A full explanation of how the mutations are described is provided after the table.
Null Alleles
| Allele | Mutation | Description of Mutation | References |
|---|---|---|---|
| A*01:01:01:02N | Deletion |
Intron 2, g478-481delGTGA, causes translation of intron 2 sequence and abnormal truncated peptide | |
| A*01:04N | Insertion |
Exon 4, 627-628insC, in codon 186 causes frameshift and premature stop at codon 196 | Laforet et al. Tissue Antigens . 1997 50:347-50 Zanone-Ramseier et al. Transplantation. 1999 67:1336-41 Poli et al. Tissue Antigens. 1999 54:300-2 |
| A*01:11N | Point |
Exon 3, 968G>T, causes alternative splice site at end of exon 3 which prevents translation into a correct and stable class I molecule expressed on the cell surface | Reinders et al. Hum Immunol. 2005 66:912-20 |
| A*01:15N | Deletion |
Exon 3, 559delC, in codon 163, causes frameshift and premature stop at codon 189 | Bera et al. Tissue Antigens. 2006 67:61-3 |
| A*01:16N | Insertion |
Exon 3, 532-533insG, in codon 154, causes frameshift and premature stop at codon 196 | |
| A*01:18N | Point |
Exon 2, 215G>C, causes R48P, which may effect the binding of beta-2 microglobulin. | Henry et al. Am J. Clin. Pathol. 2004 122:185-92 |
| A*01:22N | Deletion |
Exon 4, 751delG, in codon 227 causes frameshift and premature stop at codon 189 | |
| A*01:27N | Point |
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161 | Longhi et al. Human Immunol. 2008 68:913-4 |
| A*01:31N | Point |
Exon 2,250-252TGG>TAG, causes W60X, a premature stop at codon 60 | |
| A*01:34N | Point |
Exon 4, 705G>A, causes incorrect splicing of exon 4 | |
| A*01:52N | Point | Exon 3,469-471TGG>TAG, causes W133X, a premature stop at codon 133 | |
| A*01:53N | Point | Exon 3,547-549TAC>TAA, causes Y159X, a premature stop at codon 159 | |
| A*01:56N | Point | Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217 | |
| A*01:57N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | |
| A*02:15N | Point |
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 | Ishikawa et al. Immunogenetics. 1996 43:1-5 |
| A*02:32N | Point |
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | Bunce et al. Tissue Antigens. 2000 55:31-6 |
| A*02:43N | Insertion |
Exon 4, 779-780insC, in codon 236, causes frameshift and premature stop at codon 264 | |
| A*02:53N | Point |
Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84 | Wu et al. Tissue Antigens. 2002 59:328-30 |
| A*02:82N | Point |
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
| A*02:83N | Point |
Exon 4, 829-831GAG>TAG, causes Q253X, a premature stop at codon 253 | Hornet al. Tissue Antigens. 2005 66:335-7 |
| A*02:88N | Point |
Exon 3, 418-420GAC>TAG, causes D116X, a premature stop at codon 116 | |
| A*02:94N | Deletion |
Exon 2, 337delG, in codon 89 causes frameshift and premature stop at codon 126 | |
| A*02:113N | Point |
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 | Hammond et al. Tissue Antigens. 2008 72:176-6 |
| A*02:125N | Deletion |
Exon 2, 261delG, in codon 63, causes a frameshift and premature stop codon 67 | |
| A*02:222N | Point | Exon 3, 451-453AAA>TAA, causes K127X, a premature stop at codon 127 | |
| A*02:223N | Point | Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 | |
| A*02:225N | Point | Exon 3, 439-441TAC>TAA, causes Y123X, a premature stop at codon 123 | |
| A*02:226N | Point | Exon 3, 538-540TTG>TAG, causes L156X, a premature stop at codon 156 | |
| A*02:227N | Point | Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 | |
| A*02:250N | Deletion | Exon 2, 286-287delCA, causes frameshift and premature stop at codon 326 | |
| A*03:01:01:02N | Point |
Intron 4, g1846G>A, causes incorrect splicing and premature stop codon | |
| A*03:03N | Deletion |
Exon 3, 373-378delTGCGAC, causes deletion of codons 101-102. Codon 101 is necessary for formation of the disulphide bridge | Lienert et al. Tissue Antigens. 1996 48:187-91 |
| A*03:11N | Point |
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
| A*03:21N | Insertion |
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | |
| A*03:36N | Deletion |
Exon 2, 264-290delACGGAATATGAAGGCCC | |
| A*03:68N |
Point
|
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 | |
| A*03:69N | Point |
Exon 3, 538-540CGG>TAG, causes R156X, a premature stop at codon 156 | |
| A*11:21N | Insertion |
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | |
| A*23:07N | Insertion |
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | |
| A*23:08N | Point |
Exon 3, 562-564TGC>TGA, causes c164X, a premature stop at codon 164 | |
| A*23:11N | Insertion |
Exon 2, 150-151insAGCCCCGCTTCATCGCCGTGGGC, causes frameshift and premature stop codon 60 | |
| A*24:09N | Point |
Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop at codon 224 | Magor et al. J. Immunol. 1997 158:5242-50 |
| A*24:11N | Insertion |
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | Magor et al. J. Immunol. 1997 158:5242-50 |
| A*24:36N | Deletion |
Exon 2, 252-253delGG, in codon 60, causes frameshift and premature stop at codon 60 | Li et al. Tissue Antigens. 2002 60:184-5 |
| A*24:40N | Deletion |
Exon 4, 626-627delCC, in codon 185, causes frameshift and premature stop codon 195 | |
| A*24:45N | Deletion |
Exon 2, 101-102delCA, in codon 10, causes frameshift and premature stop codon 73 | |
| A*24:48N | Point |
Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154 | |
| A*24:60N | Point |
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
| A*24:83N | Point |
Exon 4, 697-699TAC>TAA, causes Y209X, a premature stop at codon 209 | |
| A*24:84N | Point |
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
| A*24:86N | Insertion |
Exon 3, 614-615insGAAGGAGACGCTGCAGC, in codon 181, causes frameshift and premature stop codon 195 | Yan et al. Tissue Antigens. 2009 73:63-5 |
| A*24:90N | Point |
Exon 3, 418-420GAC>TAG, causes Y116X, a premature stop at codon 116 | |
| A*24:132N | Point | Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101 | |
| A*25:12N | Point | Exon 3,547-549TAC>TAA, causes Y159X, a premature stop at codon 159 | |
| A*26:11N | Insertion |
Exon 3,516-517insAC, in codon 149, causes frameshift and premature stop codon 190 | |
| A*26:25N | Insertion |
Exon 2, 280-281insC, in codon 70, causes frameshift and premature stop at codon 74 | |
| A*29:01:01:02N | Point |
Intron 4, g1846G>A, causes incorrect splicing and premature stop codon | Elsner et al. Tissue Antigens. 2002 59:139-41 |
| A*29:08N | Point |
Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51 | |
| A*30:27N | Point |
Exon 3, 535-537GAG>TAG, causes Q155X, a premature stop at codon 155 | |
| A*31:14N | Insertion |
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 | Smith et al. Tissue Antigens. 2006 68:526-7 |
| A*32:19N | Point |
Exon 3, 571-573GGG>TGA, causes G167X, a premature stop at codon 167 | |
| A*68:11N | Deletion |
Exon 1,46delG, in codon 9, causes frameshift and premature stop at codon -6 | Laforet et al. Tissue Antigens. 1999 53:573-5 |
| A*68:18N | Insertion |
Exon 2, 213-214insCGAGCCAGAGGATGGAGCCG, in codon 48, causes frameshift and premature stop at codon 59 | Dormoy et al. Tissue Antigens. 2002 60:88-90 |
| A*68:49N | Point | Exon 3,511-513TGG>TAG, causes W147X, a premature stop at codon 147 | |
| A*74:12N | Deletion |
Exon 3, 357-362delCCAG AT, causes deletion of codons 96-97. Protein is not detected at cell surface by pan-class I antibody. | |
| A*74:14N | Point |
Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51 | |
| B*07:49N | Point |
Exon 4, 892-894TGG>TAG, causes W274X, a premature stop at codon 274 | Perrier et al. Tissue Antigens. 2007 70:341-3 |
| B*07:67N | Deletion |
Exon 2, 117delC, in codon 15, causes frameshift and premature stop at codon 34 | |
| B*07:111N | Point | Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 | |
| B*08:08N | Deletion |
Exon 3,473delC, in codon 134, causes frameshift and premature stop at codon 189 | Carter et al. Tissue Antigens. 2000 55:61-4 |
| B*08:19N | Point |
Exon 4, 724-726CAG>TAG codon 218, causes Q218X, a premature stop at codon 218 | |
| B*08:30N | Point |
Exon 3,424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
| B*13:07N | Deletion |
Exon 2, 254-268delACCGGAA CACACAGA, codons 61-65, causes no frameshift, but exon 2 is 5aa shorter | |
| B*14:07N | Point |
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
| B*15:01:01:02N | Deletion |
Intron 1, g175-184delCGGGTC TCAG, effecting splice site for exon 2 | Curran et al. Tissue Antigens. 1999 53:244-52 |
| B*15:26N | Point |
Exon 3, 367-269TAC>TAA, causes Y99X, a premature stop at codon 99 | Mine et al. Tissue Antigens. 1997 50:351-4 |
| B*15:79N | Insertion |
Exon 2, 328-329insCA, in codon 86, causes frameshift and premature stop at codon 127 | |
| B*15:94N | Point |
Exon 2, 295-295CGA>TGA, causes R75X, a premature stop at codon 75 | |
| B*15:111N | Deletion |
Exon 3, 527-538delAGGC GGAGCA, codons 152-155, causes a frameshift and premature stop at codon 186 | |
| B*15:149N | Deletion |
Exon 2, 264-265delAC, in codon 65, causes frameshift and premature stop at codon 113 | |
| B*15:181N | Point |
Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144 | |
| B*15:182N | Point |
Exon 1, 91-93TAT>TAG, causes Y7X, a premature stop at codon 7 | |
| B*15:190N | Point | Exon 3,511-513TGG>TGA, causes W147X, a premature stop at codon 147 | |
| B*18:17N | Point |
Exon 1, 40-42TCG>TAG, causes W-11X, a premature stop at codon -11 | den Hollander et al. Tissue Antigens. 2002 59:341-3 |
| B*18:23N | Point |
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 | |
| B*27:59N | Point |
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 | |
| B*27:64N | Point |
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | |
| B*27:65N | Point |
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 | |
| B*35:40N | Deletion |
Exon 4, 807delA, in codon 245, causes frameshift and premature stop at codon 272 | Dunne et al. Tissue Antigens. 2002 59:522-4 |
| B*35:53N | Deletion |
Exon 3, 473-477delCCGC, in codons 134-135, causes frameshift and premature stop at codon 155 | |
| B*35:129N | Point | Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 | |
| B*35:130N | Point | Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27 | |
| B*35:134N | Point | Exon 4, 782-784TGG>TGA, causes W224X, a premature stop at 224 | |
| B*35:145N | Insertion | Exon 3, 532-533insGCGG, in codon 154 causes a frameshift and premature stop codon at 197 | |
| B*37:03N | Point |
Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89 | |
| B*39:25N | Deletion |
Exon 3, 403-404delGC, in codon 111, causes frameshift and premature stop at codon 113 | |
| B*39:40N | Point |
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
| B*40:22N | Point |
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 | Tamouza et al. Tissue Antigens. 2000 55:378-80 |
| B*40:118N | Point | Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 | |
| B*40:142N | Deletion | Exon 2, 253delG, in codon 61, causes frameshift and premature stop at codon 251 | |
| B*40:144N | Point | Exon 4, 826-828GGA>TGA, causes G252X, a premature stop at codon 252 | |
| B*44:19N | Deletion |
Exon 1, 5delT, in codon -23, causes frameshift and premature stop codon at -6 | Bettens et al. Tissue Antigens. 2000 56:441-5 |
| B*44:23N | Point |
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | Cox et al. Tissue Antigens. 2003 61:20-48 Hammond et al. Eur. J. Immunogenet. 2003 30:385-6 |
| B*44:52N | Deletion |
Exon 3,492-505delTCAGATCAC CCAGC, in codons 141-144, causes frameshift and premature stop at codon 191 | |
| B*44:56N | Point |
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 | |
| B*44:58N | Point |
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
| B*44:61N | Point |
Exon 2,208-210GAG>TAG, causes E46X, a premature stop at codon 46 | |
| B*44:108N | Point | Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 | |
| B*46:07N | Point |
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | Tang et al. Tissue Antigens. 2006 68:518-20 |
| B*46:15N | Point |
Exon 4,736-738GAG>TAG, causes E222X, a premature stop at codon 222 | |
| B*51:11N | Insertion |
Exon 4, 627- 628insC, in codon 186 causes frameshift and premature stop at codon 196 | Elsner et al. Tissue Antigens. 2001 57:369-72 |
| B*51:27N | Point |
Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144 | Hou et al. Tissue Antigens. 2002 60:262-5 |
| B*51:41N | Point |
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 | |
| B*51:44N | Point |
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon 65 | |
| B*54:05N | Deletion |
Exon 2, 212-232delCGCGGGCGCCGTGGATAGAGC, in codons 46-54, causes no frameshift but deletion of 7aa | |
| B*54:08N | Point |
Exon 3, 553-554GAG>TAG, causes E161X, a premature stop at codon 161 | Yan et al. Tissue Antigens. 2006 68:182 |
| B*56:19N | Point |
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 | |
| B*56:28N | Point | Exon 2, 247-249TGG>TGA, causes W59X, a premature stop at codon 59 | |
| B*57:28N | Point | Exon 3, 418-420TAC>TAG, causes Y116X, a premature stop at codon 116 | |
| B*58:10N | Deletion |
Exon 3, 366delG, in codon 98, causes frameshift and premature stop at codon 126 | |
| B*58:17N | Deletion |
Exon 3, 311delA, in codon 80, causes frameshift and premature stop at codon 126 | |
| B*81:04N | Point |
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 | |
| C*01:37N | Point |
Exon 2, 361-363TGG>TGA, causes W97X, a premature stop at codon 97 | |
| C*02:38N | Point |
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 | |
| C*03:20N | Point |
Exon 1, 19-21CGA>TGA, causes R-18X, a premature stop at codon -18 | |
| C*04:09N | Deletion |
Exon 7, 1095delA, in codon 341, causes frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 32 amino acids | Balas et al. Tissue Antigens. 2002 59:95-100 |
| C*05:07N | Deletion |
Exon 3, 353-353deldAD, in codon 94, causes frameshift and premature stop codon at 113 | |
| C*06:16N | Deletion |
Exon 3, 499-500delAC, in codon 144, causes a frameshift and premature stop at codon 151 | Lebedeva et al. Tissue Antigens. 2007 70:441-2 |
| C*07:32N | Insertion |
Exon 3, 560-561insCGCAGAT, in codon 163, causes frameshift and premature stop at codon 198 | |
| C*07:33N | Deletion |
Exon 2, 92delA, in codon 7, causes frameshift and premature stop at codon 76 | Lazaro et al. Tissue Antigens. 2008 71:560-3 |
| C*07:55N | Point |
Exon 3,409-411TAT>TAG, causes Y113X, a premature stop at codon 113 | |
| C*07:104N | Point | Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
| C*07:98N | Point |
Exon 3,493-495CAG>TAG, causes Q141X, a premature stop at codon 141 | |
| C*08:36N | Point |
Exon 3,439-441TAC>TAG, causes Y123X, a premature stop at codon 123 | |
| C*12:39N | Point |
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 | |
| C*14:07N | Point |
Exon 3, 583-585TAC-TAA, causes Y171X, a premature stop at codon 171 | |
| C*14:21N | Point |
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 | |
| G*01:05N | Deletion |
Exon 3, 460delC, in codon 130, causes frameshift and premature stop at codon 171 | Suarez et al. Immunogenetics. 1997 45:464-5 Pyo et al. Immunogenetics. 2006 58:241-51 |
| G*01:13N | Point |
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 | Lajoie et al. Tissue Antigens. 2008 72:502-4 |
| DOA*01:04N | Deletion |
Exon 2, 108delC, in codon 11, causes frameshift and premature stop at codon 37 | Moon et al. Tissue Antigens. 2005 66:242-5 |
| DPB1*23:02N | Point |
Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10 | |
| DPB1*61:01N | Point |
Exon 2, 286-288GAG>TAG, causes E67X, a premature stop at codon 67 | Zimmerman et al. Tissue Antigens. 1996 47:293-9 |
| DPB1*64:01N | Point |
Exon 2, 106-108TAC>TAA, causes Y7X, a premature stop at codon 7 | Steiner et al. Tissue Antigens. 1997 49:262-6 |
| DQA1*04:03N | Point |
Exon 2, 236-238AAA>TAA, causes Q53X, a premature stop at codon 53 | Luo et al. Tissue Antigens. 2004 63:609-11 |
| DQB1*06:26N | Point |
Exon 2, 181-183AGA>TGA, causes R29X, a premature stop at codon 29 | |
| DRB1*04:81N | Deletion |
Exon 2, 296-297delAG, in codon 70, causes frameshift and premature stop at codon 86 | |
| DRB1*07:10N | Deletion |
Exon 2, 175-176delTG, in codon 30, causes frameshift and premature stop at codon 32 | Eiz-Vesper et al. Immunogenetics. 2007 59:507-10 |
| DRB1*12:24N | Point | Exon 2, 268-270TGG>TAG, causes Y61X, a premature stop at codon 61 | |
| DRB1*14:92N | Point |
Exon 2, 190-192GAG>TAG, causes E35X, a premature stop at codon 35 | |
| DRB1*15:17N | Insertion |
Exon 2, 294-295insGA, in codon70, causes frameshift and premature stop at codon 100 | Lebedeva et al. Tissue Antigens. 2005 66:334-5 |
| DRB1*16:13N | Point |
Exon 2, 241-243GAG>TAG, causes E52X, a premature stop at codon 52 | Zhao et al. Tissue Antigens. 2008 71:180-2 |
| DRB4*01:03:01:02N | Point |
Incorrect splicing results in lack of protein sequence | Sutton et al. Immunogenetics. 1990 31:112-7 Naruse et al. Tissue Antigens. 1997 49:152-9 |
| DRB4*02:01N | Deletion |
Exon 2, 155-165delGGGTGC GGTTG, in codons 23-26, causes frameshift and premature stop at codon 29 | Robbins et al. Immunogenetics. 1997 46:104-10 |
| DRB4*03:01N | Undefined |
The allele contains sequence for intron 2 and exon 3, but has no preceding exon sequences | Robbins et al. Immunogenetics. 1997 46:104-10 |
| DRB5*01:08N | Deletion |
Exon 3, 572-590delAAACAGTTC CTCGGAGTGG, in codons 162-168, causes frameshift and possible stop codon after 171 | Voorter et al. Tissue Antigens. 1997 50:326-33 |
| DRB5*01:10N | Deletion |
Exon 2, 326- 327delGA, in codon 80, causes frameshift and premature stop at codon 86 | Balas et al. Tissue Antigens. 2000 55:467-9 |
| MICB*009N | Point |
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 | Ando et al. Immunogenetics. 1997 46:499-508 |
| MICB*021N | Deletion |
Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 | Schroeder et al. Tissue Antigens. 2004 64:276-80 |
| TAP1*01:02N | Point |
Exon, 599delG, in codon 200, causes frameshift and premature stop at codon 228 | Furukawa et al. J. Clin. Invest. 1999 103:755-8 |
Alternatively Expressed Alleles
| Allele | Mutation | Description of Mutation | References |
|---|---|---|---|
| A*02:01:01:02L | Point |
Promoter Region, g-101T>C, causes a mutation in the Enhancer B region of the promoter | Balas et al. Hum Immunol. 1994 41:69-73 Perrier et al. Tissue Antigens. 2006 68:442-5 |
| A*11:50Q | Point | Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
| A*11:52Q | Deletion | Exon 2, 103-105delTCC, causes deletion of codon 11, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
| A*23:19Q | Point |
Exon 3, 619G>A, in codon 183, mutation occurs at exon boundary, potentially affecting the splice site and affecting expression | |
| A*24:02:01:02L | Point |
Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3 | Magor et al. J. Immunol. 1997 158:5242-50 Laforet et al. Tissue Antigens. 1997 50:340-6 Zanone-Ramseier et al. Transplantation. 1999 67:1336-41 Dunn et al. Tissue Antigens. 2004 63:589-91 |
| A*30:14L | Point |
Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | |
| A*32:11Q | Point |
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression | Tang et al. Tissue Antigens. 2006 68:518-20 |
| B*13:08Q | Point |
Exon 3, 547-549TAC>TGC, causes Y159C, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
| B*35:65Q | Point |
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | Elsner et al. Immunogenetics. 2006 58:929-31 |
| B*37:16Q | Point |
Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | Elsner et al. Immunogenetics. 2006 58:929-31 |
| B*39:01:01:02L | Deletion |
Promoter region, g-151-152delTC, causes a decrease in promoter activity and low expression of the allele is seen | |
| B*39:38Q | Point |
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | Tang et al. Tissue Antigens. 2006 68:518-20 |
| B*40:133Q | Point |
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-B and affecting expression | |
| B*44:02:01:02S | Point |
Intron 4, g1934A>G, causes an incorrect splicing leading to the deletion of exon 5 | Dubois et al. Tissue Antigens. 2004 63:173-80 |
| C*02:25Q | Point |
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
| C*03:22Q | Point |
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | Middleton et al. Tissue Antigens. 2006 67:343-5 |
| C*04:59Q | Point |
Exon 3, 562-564TGC>TAG, causes C161Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | Middleton et al. Tissue Antigens. 2006 67:343-5 |
| C*07:121Q | Point |
Exon 3, 562-564TGC>CGC, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
| C*12:42Q | Point |
Exon 3, 562-564TGC>TGG, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
| C*15:32Q | Point |
Exon 3,562-564TGC>GGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | |
| C*16:16Q | Point |
Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression | Middleton et al. Tissue Antigens. 2006 67:343-5 |
Describing the mutations
The following recommendations are used for describing mutations in nucleotide sequences;
- The numbering of the nucleotides in the reference sequence should remain constant.
- For both gDNA and cDNA the A of the ATG initiator Methionine codon has been denoted nucleotide +1.
- The nucleotide immediately preceding the A of the ATG initiator Methionine codon has been denoted nucleotide -1. Note: that there is no nucleotide 0.
- gDNA numbering is identified by the prefix g. For example; g708G>A refers to position 708 of the gDNA and not 708 of the cDNA sequence.
- Nucleotide substitutions are designated using the nucleotide number, followed by the substitution. For example; 997G>T denotes a substitution of G to T at position 997 of the DNA sequence.
- Deletions are designated by 'del' after the nucleotide number. For example; 997delT denotes the deletion of a T at position 997 of the DNA. For deletions of a number of consecutive bases the mutation should be described as 997-998delTG which denotes a deletion of TG at positions 997 and 998 of the DNA.
- Insertions are designated by 'ins' after the nucleotide numbers bordering the insertion. For example; 997-998insT, represents an insertion of T between bases 997 and 998 of the DNA. In the alignments produced this will be represented by a period (.), but the numbering of the reference sequence will not be altered to include this base. Insertions of multiple bases are designated using the same form, 997-998insTG denotes an insertion of TG between positions 997 and 998 of the DNA.
Mutations in protein sequences follow a similar format;
- The numbering of the amino acids in the reference sequence should remain constant.
- For amino acid-based systems, the start codon of the mature protein is labeled codon 1.
- The codon 5' to this is numbered -1.
- For amino acid nomenclature the reference amino acid is listed first followed by the codon and then the mutation. For example; Y97S represents a substitution of the Tyrosine at codon 97 for a Serine.
- Stop codons are always designated by X. For example; T97X represents a Threonine substituted for a stop codon.
- Deletions are again designated used 'del'. For example; T97del is the deletion of a Threonine at codon 97.
- Insertions again follow the 'ins' convention. For example; T97-98ins represents a Threonine inserted between codons 97 and 98


