Null and Alternatively Expressed Alleles

Assigned as of July 2014

We list here all HLA alleles which have been shown to either not to be expressed, Null alleles, that have the suffix 'N' and those alleles which have been shown to be alternatively expressed have the suffix 'L', 'S', 'C', 'A' or 'Q'.

The suffix 'L' is used to indicate an allele which has been shown to have 'Low' cell surface expression when compared to normal levels. The 'S' suffix is used to denote an allele specifying a protein which is expressed as a soluble 'Secreted' molecule but is not present on the cell surface. A 'C' suffix to indicate an allele product which is present in the 'Cytoplasm' but not on the cell surface. An 'A' suffix to indicate 'Aberrant' expression where there is some doubt as to whether a protein is expressed. A 'Q' suffix when the expression of an allele is 'Questionable' given that the mutation seen in the allele has previous¤ly been shown to effect normal expression levels.

As of July 2014 no alleles have been named which use the 'C' or 'A' suffix.

All numbering and descriptions are based on alignment to the exon sequence of the standard reference allele for that locus e.g.; A*01:01:01:01 for null HLA-A alleles. A full explanation of how the mutations are described is provided after the table.

Null Alleles

Allele Mutation      Description of Mutation References
A*01:01:01:02N Deletion
Intron 2, g478-481delGTGA, causes translation of intron 2 sequence and abnormal truncated peptide 
A*01:04N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196Tissue Antigens (1997) 50:347-50
Transplantation (1999) 67:1336-41
Tissue Antigens (1999) 54:300-2
Tissue Antigens (1999) 54:300-2
Tissue Antigens (1999) 54:300-2
 
A*01:11N Point
Exon 3, 968G>T, causes alternative splice site at end of exon 3 which prevents translation into a correct and stable class I molecule expressed on the cell surfaceHum Immunol (2005) 66:912-20
Hum Immunol (2005) 66:912-20
 
A*01:15N Deletion
Exon 3, 559delC, in codon 163, causes frameshift and premature stop at codon 189Tissue Antigens (2006) 67:61-3
Tissue Antigens (2009) 73:364-72
 
A*01:16N Insertion
Exon 3, 532-533insG, in codon 154, causes frameshift and premature stop at codon 196 
A*01:18N Point
Exon 2, 215G>C, causes R48P, which may effect the binding of beta-2 microglobulin.American Journal of Clinical Pathology (2004) 122:185-92
 
A*01:22N Deletion
Exon 4, 751delG, in codon 272 causes frameshift and premature stop at codon 272 
A*01:27N Point
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161Human Immunology (2008) 68:913-4
 
A*01:31N Point
Exon 2,250-252TGG>TAG, causes W60X, a premature stop at codon 60Tissue Antigens (2010) 76:149-150
 
A*01:52N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133Tissue Antigens (2014) 83:184-189
 
A*01:53N Point
Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159 
A*01:56N Point
Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217 
A*01:57N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
A*01:87N Deletion
Exon 4, 723delG, in codon 217, causes frameshift and premature stop at codon 272 
A*01:123N Deletion
Exon 3, 610delC, in codon 180, causes frame shift and premature stop codon at codon 189 
A*01:160N Point
Exon 3, 535C>T, causes Q155X, a premature stop codon at 155 
A*01:162N Point
Exon 2, 286C>T, causes L72X, a premature stop codon at 72 
A*02:15N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257Immunogenetics (1996) 43:1-5
 
A*02:32N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141Tissue Antigens (2000) 55:31-6
 
A*02:43N Insertion
Exon 4, 779-780insC, in codon 236, causes frameshift and premature stop at codon 264 
A*02:53N Point
Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84Tissue Antigens (2002) 59:328-30
 
A*02:82N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
A*02:83N Point
Exon 4, 829-831GAG>TAG, causes Q253X, a premature stop at codon 253Tissue Antigens (2005) 66:335-7
 
A*02:88N Point
Exon 3, 418-420GAC>TAG, causes D116X, a premature stop at codon 116 
A*02:94N Deletion
Exon 2, 337delG, in codon 89, causes frameshift and premature stop at codon 126 
A*02:113:01N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60Tissue Antigens (2008) 72:176-7
 
A*02:113:02N Point
Exon 2, 252G>A, causes W60X, a premature stop codon at 60 
A*02:125N Deletion
Exon 2, 261delG, in codon 63, causes a frameshift and premature stop codon 67Tissue Antigens (2009) 74:424-428
 
A*02:222N Point
Exon 3, 451-453AAA>TAA, causes K127X, a premature stop at codon 127 
A*02:223N Point
Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115Tissue Antigens (2014) 83:184-189
 
A*02:225N Point
Exon 3, 439-441TAC>TAA, causes Y123X, a premature stop at codon 123Tissue Antigens (2014) 83:184-189
 
A*02:226N Point
Exon 3, 538-540TTG>TAG, causes L156X, a premature stop at codon 156 
A*02:227N Point
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180Tissue Antigens (2013) 81:46-47
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
A*02:250N Deletion
Exon 2, 286-287delCA, in codons 71-72, causes frameshift and premature stop at codon 195 
A*02:284N Point
Exon 3, 391-393TGG>TAG, causes W107X, a premature stop at codon 107 
A*02:301N Deletion
Exon 3, 426delC, in codon 118, causes frameshift and premature stop at codon 118 
A*02:305N Deletion
Exon 4, 814delG, in codon 248, causes frameshift and premature stop at codon 272Tissue Antigens (2012) 79:130-131
 
A*02:314N Point
Exon 3, 408-411 TAC>TAG, causes Y113X, a premature stop at codon 113 
A*02:321N Point
Exon 2, 244-246GAG>TAG, causes Q58X, premature stop at codon 58 
A*02:350N Point
Exon 2, 337-339GAG>TAG causes E89X, a premature stop at codon 89Tissue Antigens (2014) 83:184-189
 
A*02:356N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257Tissue Antigens (2013) 42:136-137
 
A*02:366N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2014) 83:184-189
 
A*02:373N Point
Exon 3, 514-516GAG>TAG, causes E148X, a premature stop at codon 148 
A*02:395N Point
Exon 2, 268A>T, causes N66X, a premature stop at codon 66Tissue Antigens (2013) 81:451-452
 
A*02:439N Point
Exon 3, 585G>T, causes E161X, a premature stop codon at 161. 
A*02:468:01N Point
Exon 3, 573G>A, causes W167X, a premature stop codon at 167 
A*02:468:02N Point
Exon 3, 572G>A, causes W167X, a premature stop codon at 167 
A*02:476N Point
Exon 3, 513G>A, causes W147X, a premature stop codon at 147 
A*02:490N Point
Exon 3, 375C>A, causes C101X, a premature stop codon at 101 
A*02:501N Point
Exon 3, 585C>G, causes Y171X, a premature stop codon at 171 
A*02:506N Insertion
Exon 4, 736>737InsG, in codon 222, causes a frame shift and a premature stop codon at 269 
A*02:514N Point
Exon 2, 249T>G, causes Y57X, a premature stop codon at 59 
A*02:516N Point
Exon 3, 375C>A, causes C101X, a premature stop codon at 101 
A*02:525N Point
Exon 2, 153C>A, causes Y27X , a premature stop codon at 27 
A*02:540N Point
Exon 3, 369T>G, causes Y99X, a premature stop codon at 99 
A*03:01:01:02N Point
Intron 4, g1846G>A, causes incorrect splicing and premature stop codon 
A*03:03N Deletion
Exon 3, 373-378delTGCGAC, causes deletion of codons 101-102. Codon 101 is necessary for formation of the disulphide bridgeTissue Antigens (1996) 48:187-91
 
A*03:11N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
A*03:21N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*03:36N Deletion
Exon 2, 264-290delACGGAATATGAAGGCCC, codon 64-73, causes frameshift and premature stop at codon ??? 
A*03:68N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87Tissue Antigens (2014) 83:184-189
 
A*03:69N Point
Exon 3, 538-540CGG>TAG, causes R156X, a premature stop at codon 156Tissue Antigens (2014) 83:184-189
 
A*03:91N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85Tissue Antigens (2014) 83:184-189
 
A*03:129N Deletion
Exon 4, 651delC, in codon 193, causes frameshift and premature stop at codon 201 
A*03:161N Point
Exon 2, 127-129 GAG>TAG, causes E19X, a premature stop at codon 19 
A*03:162N Insertion
Exon 4, 664-665insCATG, in codon 198, causes frame shift and premature stop at codon 199Tissue Antigens (2014) 83:53-54
 
A*03:168N Point
Exon 2, 153C>A, causes Y27X, a premature stop codon at 27Tissue Antigens (2014) 83:195-196
 
A*03:178N Point
Exon2, 295C>T, causes R75X, a premature stop codon at 75 
A*03:192N Point
Exon 3, 513G>A, causes W147X, a premature stop codon at 147 
A*03:197N Point
Exon 3, 411C>G, causes Y113X, a premature stop codon at 113 
A*11:21N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*11:69N Point
Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217Tissue Antigens (2014) 83:292-293
 
A*11:78N Deletion
Exon 2, 285-286delAC, causes frameshift and premature stop codon at 73Tissue Antigens (2011) 77:257-258
 
A*11:99N Deletion
Exon 2, 153delC, in codon 27, causes frameshift and premature stop at codon 27 
A*11:109N Point
Exon 3, 511-514TGG>TGA, causesW147X, a premature stop at codon 147 
A*11:115N Point
Exon 2, 151-153TAC>TAA , causes Y27X, a premature stop at codon 27 
A*11:127N Point
Exon 3, 583-585TAC>TAA , causes Y171X, a premature stop at codon 171 
A*11:137N Point
Exon 3, 426C>G, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
 
A*11:180N Deletion
Exon 2, 307delG, in codon 79, causes a frame shift and a premature stop codon at 97 
A*11:208N Point
Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51 
A*23:07N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*23:08N Point
Exon 3, 562-564TGC>TGA, causes c164X, a premature stop at codon 164 
A*23:11N Insertion
Exon 2, 150-151insAGCCCCGCTTCATCGCCGTGGGC, causes frameshift and premature stop codon 60 
A*23:38N Deletion
Exon 2, 303delC in codon 77, causes frameshift and premature stop at codon 97Tissue Antigens (2012) 79:71-72
 
A*24:09N Point
Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop at codon 224J Immunol (1997) 158:5242-50
 
A*24:11N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196J Immunol (1997) 158:5242-50
 
A*24:36N Deletion
Exon 2, 252-253delGG, in codon 60-61, causes frameshift and premature stop at codon 60Tissue Antigens (2002) 60:184-5
 
A*24:40N Deletion
Exon 4, 626-627delCC, in codon 185, causes frameshift and premature stop codon 196 
A*24:45N Deletion
Exon 2, 101-102delCA, in codon 10, causes frameshift and premature stop codon 73 
A*24:48N Point
Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154 
A*24:60N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
A*24:83N Point
Exon 4, 697-699TAC>TAA, causes Y209X, a premature stop at codon 209 
A*24:84N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
A*24:86N Insertion
Exon 3, 614-615insGAAGGAGACGCTGCAGC, in codon 181, causes frameshift and premature stop codon 195Tissue Antigens (2009) 73:63-65
 
A*24:90N Point
Exon 3, 418-420GAC>TAG, causes Y116X, a premature stop at codon 116Tissue Antigens (2010) 76:319-324
Tissue Antigens (2010) 76:319-324
 
A*24:132N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101Tissue Antigens (2012) 80:464-465
 
A*24:155N Deletion
Exon 4, 740delA, causes frameshift and premature stop codon at 272Tissue Antigens (2011) 78:267-270
 
A*24:158N Deletion
Exon 3, 453-454delCG, causes frameshift and premature stop at codon 195 
A*24:163N Point
Exon 4/5, 895-897GAG>TAG, causesW275X, a premature stop at codon 275Tissue Antigens (2011) 78:267-270
 
A*24:183N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257Tissue Antigens (2013) 42:136-137
 
A*24:185N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 
A*24:222N Deletion
Exon 3, 355-357delC, in codon 96, causes frame shift and premature stop at codon 97 
A*24:232N Insertion
Exon 2, 113-114insTCCCG, in codon 14, causes a frame shift and a premature stop codon at codon 54 
A*24:240N Point
Exon 2, 324C>G, causes Y84X, a premature stop codon at 84 
A*24:252N Deletion
Exon 2, 282delC, in codon 70, causes a premature stop codon at 108 
A*24:278N Point
Eon 3, 549C>G, causes Y159X, a premature stop codon at 159 
A*25:12N Point
Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159Tissue Antigens (2014) 83:184-189
 
A*26:11N Insertion
Exon 3, 516-517insAC, in codon 149, causes frameshift and premature stop codon 190 
A*26:25N Insertion
Exon 2, 280-281insC, in codon 70, causes frameshift and premature stop at codon 74 
A*26:60N Point
Exon 3, 424-426>TAC>TAG, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
 
A*26:71N Point
Exon 2, 223-225>TGG>TAG, causes W51X, a premature stop at codon 51Tissue Antigens (2014) 83:184-189
 
A*29:01:01:02N Point
Intron 4, g1846G>T, causes incorrect splicing and premature stop codonTissue Antigens (2002) 59:139-41
 
A*29:08N Point
Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51 
A*30:27N Point
Exon 3, 535-537GAG>TAG, causes Q155X, a premature stop at codon 155 
A*30:59N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 
A*30:70N Deletion
Exon 2, 208-210delG, in codon 46, causes frame shift and premature stop at codon 52 
A*30:73N Insertion
Exon 3, 516-517insCGGACATGGCGGCTCAGATCACCCAGCGCAAGTGGGAG, in codon 148, causes a frame shift and a premature stop codon at codon 169 
A*30:76N Point
Exon 2, 127G>T, causes E19X, a premature stop codon at 19 
A*30:78N Deletion
Exon2, 188delA, in codon 39, causes a frame shift and premature stop codon at codon 54 
A*31:14N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196Tissue Antigens (2006) 68:526-7
 
A*31:60N Point
Exon 3, 373-375TGC>TGA , causes G101X, a premature stop at codon 101 
A*32:19N Point
Exon 3, 571-573GGG>TGA, causes G167X, a premature stop at codon 167Tissue Antigens (2009) 74:553-554
 
A*32:27N Point
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
A*32:45N Point
Exon 3, 508-510AAG>TAG, causes K146X, a premature stop at codon 146Tissue Antigens (2014) 83:184-189
 
A*32:48N Point
Exon 3, 409-411 TAC>TAG, causes Y113X, a premature stop at codon 113Tissue Antigens (2014) 83:184-189
 
A*32:56N Deletion
Exon 2, 233delA, in codon 54, causes frame shift and premature stop codon at codon 67 
A*33:73N Insertion
Exon 3, 627>628InsC, in codon 186, causes a frame shift and a premature stop codon at 196 
A*33:74N Point
Exon 3, 803G>A, causes W244X, a premature stop codon at 244 
A*33:80N Point
Exon 3, 426C>G, causes Y118X, a premature stop codon at 118 
A*34:10N Point
Exon 3, 415-417 CAG-TAG, causes Q115X, a premature stop at codon 115 
A*68:11N Deletion
Exon 1, 46delG, in codon 9, causes frameshift and premature stop at codon -6Tissue Antigens (1999) 53:573-5
 
A*68:18N Insertion
Exon 2, 213-214insCGAGCCAGAGGATGGAGCCG, in codon 47-48, causes frameshift and premature stop at codon 59Tissue Antigens (2002) 60:88-90
 
A*68:49N Point
Exon 3,511-513TGG>TAG, causes W147X, a premature stop at codon 147Tissue Antigens (2014) 83:184-189
 
A*68:59N Point
Exon 3, 511-513TGG>TAG, causes W147X, a premature stop at codon 147Tissue Antigens (2014) 83:184-189
 
A*68:94N Point
Exon 2, 253-255TGG>TAG , causes W51X, a premature stop at codon 51 
A*68:120N Point
Exon 3, 386C>A, causes S105X, a premature stop codon at 105 
A*74:12N Deletion
Exon 3, 357-362delCCAG AT, causes deletion of codons 95-97. Protein is not detected at cell surface by pan-class I antibody. 
A*74:14N Point
Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51 
B*07:49N Point
Exon 4, 892-894TGG>TAG, causes W274X, a premature stop at codon 274Tissue Antigens (2007) 70:341-3
 
B*07:67N Deletion
Exon 2, 117delC, in codon 15, causes frameshift and premature stop at codon 34 
B*07:111N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
B*07:135N Point
Exon 3, 553-555GAG>TAG, causes G161X, premature stop at codon 161 
B*07:161N Insertion
Exon 5, 151T, in codon 297, causes a frame shift and premature stop at codon 308 
B*07:167N Point
Exon 3, 502-504 CAG-TAG, causes Q144X, a premature stop at codon 144Tissue Antigens (2014) 83:184-189
 
B*07:181N Point
Exon 2, 265C>T, causes Q65X, a premature stop at codon 65Tissue Antigens (2014) 83:184-189
 
B*07:182N Point
Exon 3, 420C>A, causes Y116X, a premature stop codon at 116 
B*07:201N Point
Exon 3, 502C>T, causes Q502X, a premature stop codon at 144 
B*07:231N Point
Exon 2, 324C>G, causes Y84X, a premature stop codon at 84 
B*08:08N Deletion
Exon 3,473delC, in codon 134, causes frameshift and premature stop at codon 189Tissue Antigens (2000) 55:61-4
 
B*08:19N Point
Exon 4, 724-726CAG>TAG codon 218, causes Q218X, a premature stop at codon 218 
B*08:30N Point
Exon 3,424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
B*08:67N Point
Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51 
B*08:72N Point
Exon 2, 295-297CGA>TGA, causes R75X, premature stop at codon 75Tissue Antigens (2014) 83:184-189
 
B*08:82N Point
Exon 3, 589-591GAG>TAG, causes E173X, a premature stop at codon 173Tissue Antigens (2014) 83:184-189
 
B*08:86N Point
Exon 3, 571-573TGG>TGA, causes W167X, a premature stop at codon 167Tissue Antigens (2014) 83:184-189
 
B*13:07N Deletion
Exon 2, 254-268delACCGGAA CACACAGA, codons 61-66, causes no frameshift, but exon 2 is 5aa shorter 
B*13:49N Point
Exon 3, 439-441TAC>TAA, causes Y123X, premature stop at codon 123Tissue Antigens (2014) 83:184-189
 
B*13:56:01N Point
Exon 3, 424-426TAC>TAA, casues Y118X, premature stop at codon 118Tissue Antigens (2014) 83:184-189
 
B*13:56:02N Point
Exon 3, 426A>G, causes X118X, a premature stop codon at 118 
B*13:63N Insertion
Exon 3, 583-585insA, in codon 171, causes frame shift and premature stop at codon 171Tissue Antigens (2013) 81:459-460
 
B*13:76N Point
Exon 3, 358C>T, causes Q96X, a premature stop codon at 96 
B*14:07N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
B*14:41N Deletion
Exon 3, 523delC, in codon 151, causing frame shift and premature stop codon at 156 
B*15:01:01:02N Deletion
Intron 1, g175-184delCGGGTC TCAG, effecting splice site for exon 2Tissue Antigens (1999) 53:244-52
 
B*15:26N Point
Exon 3, 367-269TAC>TAA, causes Y99X, a premature stop at codon 99Tissue Antigens (1997) 50:351-4
 
B*15:79N Insertion
Exon 2, 328-329insCA, in codon 86, causes frameshift and premature stop at codon 127 
B*15:94N Point
Exon 2, 295-295CGA>TGA, causes R75X, a premature stop at codon 75 
B*15:111N Deletion
Exon 3, 527-538delAGGC GGAGCA, codons 152-155, causes a frameshift and premature stop at codon 186 
B*15:149N Deletion
Exon 2, 264-265delAC, in codon 64-65, causes frameshift and premature stop at codon 113Tissue Antigens (2009) 74:447-449
 
B*15:181N Point
Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
B*15:182N Point
Exon 2, 91-93TAT>TAG, causes Y7X, a premature stop at codon 7Tissue Antigens (2014) 83:184-189
 
B*15:190N Point
Exon 3,511-513TGG>TGA, causes W147X, a premature stop at codon 147Tissue Antigens (2014) 83:184-189
 
B*15:209N Point
Exon 3, 469-471TGG>TGA, causes W133X, a premature stop at codon 133Tissue Antigens (2011) 78:267-270
 
B*15:226N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87 
B*15:246N Deletion
Exon 2, 264-265delAC, in codon 64-65, causes frameshift and premature stop at codon 113 
B*15:258N Point
Exon 3, 583-585 TAC-TAA, causes Y171X, a premature stop at codon 171 
B*15:262N Point
Exon 3,367-369insGACG, in codon 99, causes frame shift and premature stop at codon 115 
B*15:272N Point
Exon 3, 426C>G, causes Y118X, a premature stop codon at 118 
B*15:294N Point
Exon2, 295C>T, causes R75X, a premature stop codon at 75 
B*15:302N Deletion
Exon 4, 723delG, in codon 217, causes frame shift and premature stop codon at 314 
B*15:304N Deletion
Exon 2, 137>147delTCATCGCAGTG, in codon 22>25, causes a frame shift and a premature stop codon at 192 
B*18:17N Point
Exon 1, 40-42TCG>TAG, causes W-11X, a premature stop at codon -11Tissue Antigens (2002) 59:341-3
 
B*18:23N Point
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 
B*18:74N Point
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161Tissue Antigens (2014) 83:184-189
 
B*18:94N Point
Exon 2, 294C>A, causes Y74X, a premature stop codon at 74. 
B*27:59N Point
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72Tissue Antigens (2011) 78:195-202
 
B*27:64N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
 
B*27:65N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54Tissue Antigens (2014) 83:184-189
 
B*27:66N Deletion
Exon 3, 547delT, in codon 159, causes a frame shift and a premature stop codon at 246 
B*27:94N Point
Exon 2, 250-252 TGG-TAG, causes W60X, a premature stop at codon 60 
B*35:40N Deletion
Exon 4, 807delA, in codon 245, causes frameshift and premature stop at codon 272Tissue Antigens (2002) 59:522-4
 
B*35:53N Deletion
Exon 3, 473-477delCCGC, in codons 134-135, causes frameshift and premature stop at codon 155 
B*35:129N Point
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72Tissue Antigens (2014) 83:184-189
 
B*35:130N Point
Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27Tissue Antigens (2014) 83:184-189
 
B*35:134N Point
Exon 4, 782-784TGG>TGA, causes W224X, a premature stop at 244 
B*35:145N Insertion
Exon 3, 532-533insGCGG, in codon 154 causes a frameshift and premature stop codon at 197 
B*35:165N Point
Exon 3,373-375TGC>TGA, causes C101X, a premature stop at 101 
B*35:173N Point
Exon 2, 222-225TGG>TAG, causes W51X, premature stop at codon 51Tissue Antigens (2014) 83:184-189
 
B*35:216N Point
Exon 2, 331-333 CAG-TAG, causes Q87X, a premature stop at codon 87 
B*37:03N Point
Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89 
B*37:30N Point
Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133 
B*37:33N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60Tissue Antigens (2014) 83:184-189
 
B*37:42N Deletion
Exon 2, 213delC, in codon 47, causes a premature stop codon at 52 
B*38:34N Point
Exon 2, 286-288CAG>TAG, causes Q72X, premature stop at codon 72Tissue Antigens (2014) 83:184-189
 
B*39:25N Deletion
Exon 3, 403-404delGC, in codon 111, causes frameshift and premature stop at codon 113 
B*39:40:01N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
B*39:40:02N Point
Exon 3, 562-564 TGC-TGA, causes C164X, a premature stop at codon 164 
B*39:87N Point
Exon 2, 331C>T, causes Q87X, a premature stop codon at 87 
B*39:95N Point
Exon 3, 493C>T, causes Q141X, a premature stop codon at 141 
B*39:97N Insertion
Exon 3, 604>605insGA, in codon 178, causes frame shift and premature stop codon at 190 
B*40:22N Point
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58Tissue Antigens (2000) 55:378-80
 
B*40:118N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
 
B*40:142N Deletion
Exon 2, 253delG, in codon 60, causes frameshift and premature stop at codon 251 
B*40:144N Point
Exon 4, 826-828GGA>TGA, causes G252X, a premature stop at codon 252Tissue Antigens (2011) 78:267-270
 
B*40:155:01N Insertion
Exon 3, 593-594insCAGAA, in codon 174, causes frameshift and premature stop at codon 191Tissue Antigens (2011) 78:154-155
 
B*40:155:02N Insertion
Exon 3, 593-594insCAGAA, in codon 174, causes frameshift and premature stop at codon 191 
B*40:216N Deletion
Exon 3, 385delC, in codon 105, causes a frame shift and a premature stop codon at 126 
B*40:256N Deletion
Exon2, 301>302delAG, in codon 77, causes a frame shift and a premature stop codon at 113 
B*40:263N Point
Exon 3, 580A>T, causes R170X, a premature stop codon at 170 
B*40:265N Point
Exon 3, 580A>T, causes R170X, a premature stop codon at 170 
B*40:286N Point
Exon 3, 426C>G, causes Y118X , a premature stop codon at 118 
B*40:291N Point
Exon 3, 454G>T, causes E128X, a premature stop codon at 128 
B*44:19N Deletion
Exon 1, 5delT, in codon -23, causes frameshift and premature stop codon at -6Tissue Antigens (2000) 56:441-5
 
B*44:23N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141Tissue Antigens (2003) 61:20-48
Eur J Immunogenet (2003) 30:385-6
 
B*44:52N Deletion
Exon 3,492-505delTCAGATCACCCAGC, in codons 140-145, causes frameshift and premature stop at codon 191 
B*44:56N Point
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99Tissue Antigens (2009) 73:607-609
 
B*44:58N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2009) 74:238-240
 
B*44:61N Point
Exon 2,208-210GAG>TAG, causes E46X, a premature stop at codon 46 
B*44:108N Point
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180Tissue Antigens (2012) 79:50-57
 
B*44:149N Point
Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop at codon 96Tissue Antigens (2014) 83:184-189
 
B*44:171N Point
Exon 2, 259A>T, causes E63X, a premature stop at codon 63Tissue Antigens (2014) 83:184-189
 
B*44:195N Point
Exon 3, 572C>G, causes S167X, a premature stop codon at 167 
B*44:198N Point
Exon 3. 426C>G, causes Y118X, a premature stop codon at 118 
B*46:07N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164Tissue Antigens (2006) 68:518-20
 
B*46:15N Point
Exon 4,736-738GAG>TAG, causes E222X, a premature stop at codon 222 
B*46:41N Deletion
Exon 2, 268>280delAGCCGAGGCACA, in codon 66-70, causes a frame shift and premature stop codon at 72 
B*46:55N Point
Exon 3, 470G>A, causes W133X, a premature stop codon at 133 
B*49:19N Point
Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133 
B*51:11N Insertion
Exon 4, 627- 628insC, in codon 186 causes frameshift and premature stop at codon 196Tissue Antigens (2001) 57:369-72
 
B*51:27N Point
Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144Tissue Antigens (2002) 60:262-5
 
B*51:41N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
B*51:44N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon 65 
B*51:98N Point
Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19Tissue Antigens (2014) 83:184-189
 
B*51:110N Point
Exon 2, 325-327TAC>TAG, causes Y85X, a premature stop codon 85Tissue Antigens (2014) 83:184-189
 
B*51:118N Deletion
Exon 2, 264-265delAC, in codons 64-65, causes frameshift and premature stop at codon 113 
B*51:149N Deletion
Exon 3, 611delA, in codon 180, causes frame shift and premature stop codon at codon 189 
B*51:178N Point
Exon 2, 244G>T, causes E58X, a premature stop codon at 58 
B*51:184N Point
Exon 2, 166>168CAG>TAG, causes Q32X, a premature stop in codon 32 
B*54:05N Deletion
Exon 2, 212-232delCGCGGGCGCCGTGGATAGAGC, in codons 47-54, causes no frameshift but deletion of 7aa 
B*54:08N Point
Exon 3, 553-554GAG>TAG, causes E161X, a premature stop at codon 161Tissue Antigens (2006) 68:182-182
 
B*55:55N Point
Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159Tissue Antigens (2014) 83:184-189
 
B*56:19N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
B*56:28N Point
Exon 2, 247-249TGG>TGA, causes W59X, a premature stop at codon 59 
B*56:38N Point
Exon 2, 166-168 CAG-TAG, causes Q32X, a premature stop at codon 32Tissue Antigens (2014) 83:184-189
 
B*57:28N Point
Exon 3, 418-420TAC>TAG, causes Y116X, a premature stop at codon 116Int J Immunogenet (2010) 37:299-300
 
B*58:10N Deletion
Exon 3, 366delG, in codon 98, causes frameshift and premature stop at codon 126 
B*58:17N Deletion
Exon 3, 311delA, in codon 80, causes frameshift and premature stop at codon 126Tissue Antigens (2009) 73:364-72
 
B*58:31N Deletion
Exon 4, 872-894delCGAAGCCCCTCACCCTGAGATGG, causes a premature stop at codon 300 
B*58:39N Point
Exon 2, 208-210 GAG-TAG, causes E46X, a premature stop at codon 46Tissue Antigens (2014) 83:184-189
 
B*81:04N Point
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58Tissue Antigens (2009) 73:364-72
 
C*01:37N Point
Exon 3, 361-363TGG>TGA, causes W97X, a premature stop at codon 97 
C*01:56N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 
C*01:69N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2014) 83:184-189
 
C*01:86N Deletion
Exon3, 421delG, in codon 117, causes a frame shift and a premature stop codon at 126 
C*01:89N Point
Exon 4, 843C>G, causes Y257X, a premature stop codon at 257 
C*01:98N Deletion
Exon 2, 285>286delAC, in codons 72>73, causing frame shift and premature stop codon at 73 
C*02:38N Point
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
C*02:52N Point
Exon 2, 151-153TAC>TAA, causes Y27X, premature stop at codon 27Tissue Antigens (2014) 83:184-189
 
C*03:20N Point
Exon 1, 19-21CGA>TGA, causes R-18X, a premature stop at codon -18 
C*03:121N Point
Exon 3, 511-513TGG>TGA, causes W147X, premature stop at codon 147 
C*03:189N Point
Exon 2, 153C>G, causes Y27X, a premature stop codon at 27 
C*03:201N Point
Exon 3, 585C>G, causes Y171X, a premature stop codon at 171. 
C*03:208N Point
Exon 2, 273C>A, causes Y67X, a premature stop codon at 67 
C*03:224N Point
Exon 4, 728G>A, causes W219X, a premature stoop codon at 219 
C*03:229N Point
Exon3, 470G>A, causes W133X, a premature stop codon at 133 
C*03:265N Point
Exon 3, 426C>G, causes Y118X, a premature stop codon at 118 
C*04:09N Deletion
Exon 7, 1095delA, in codon 341, causes frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 32 amino acidsTissue Antigens (2002) 59:95-100
Tissue Antigens (2002) 59:95-100
Human Immunology (2013) 74:325-329
 
C*04:88N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87Tissue Antigens (2014) 83:184-189
 
C*04:93N Point
Exon 3, 373-375TGC>TGA, causes C101X, premature stop at codon 101Tissue Antigens (2014) 83:184-189
 
C*04:95N Point
Exon 3, 547-549TAC>TAA, causes W159X, premature stop at codon 159Tissue Antigens (2014) 83:184-189
 
C*04:105N Point
Exon 2, 247-249TAT>TAG, causes Y59X, a premature stop at codon 59Tissue Antigens (2014) 83:184-189
 
C*04:115N Point
Exon 2, 49-51GAG>TAG, causes A49X, a premature stop at codon 49Tissue Antigens (2014) 83:184-189
 
C*04:123N Point
Exon 2, 115-117CAG>TAG, causes Q115X, a premature stop at codon 115 
C*04:170N Point
Exon 2, 327C>A, causes Y85X, a premature stop codon at 85 
C*04:173N Point
Exon 2, 268A>T, causes K66X, a premature stop codon at 66 
C*05:07N Deletion
Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop codon at 113 
C*05:48N Point
Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32Tissue Antigens (2014) 83:184-189
 
C*05:91N Point
Exon 2, 337T>G, causes E89X, a premature stop codon at 89 
C*05:92N Point
Exon 2, 175C>T, causes Q35X, a premature stop codon at 35 
C*05:99N Deletion
Exon3, 384delG, in codon 104, causes a frame shift and a premature stop codon at 126Tissue Antigens (2014) 84:420-421
 
C*06:16N Deletion
Exon 3, 499-500delAC, in codon 143, causes a frameshift and premature stop at codon 151Tissue Antigens (2007) 70:441-2
 
C*06:46N Point
Exon 4, 742-744CAA>TAA, causes Q224X, a premature stop at codon 224 
C*06:49N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101Tissue Antigens (2014) 83:184-189
 
C*06:79N Point
Exon 3, 538-540TGG>TGA, causes R156X, a premature stop at codon 156 
C*06:116N Deletion
Exon 3, 615>619delCGCGG, in codon 181, causes a premature stop codon at 198 
C*06:128N Point
Exon 2, 232C>T, causes Q54X, a premature stop codon at 54 
C*06:134N Point
Exon 2, 265G>T, causes Q65X, a premature stop codon at 65 
C*07:32N Insertion
Exon 3, 560-561insCGCAGAT, in codon 163, causes frameshift and premature stop at codon 198 
C*07:33N Deletion
Exon 2, 92delA, in codon 7, causes frameshift and premature stop at codon 76Tissue Antigens (2008) 71:560-3
 
C*07:55N Point
Exon 3,409-411TAT>TAG, causes Y113X, a premature stop at codon 113Tissue Antigens (2012) 79:139-139
 
C*07:61N Point
Exon 2,280-282CAG>TAG, causes Q70X, a premature stop at codon 70 
C*07:98N Point
Exon 3,493-495CAG>TAG, causes Q141X, a premature stop at codon 141Tissue Antigens (2014) 83:184-189
 
C*07:104N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
 
C*07:152N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2014) 83:184-189
 
C*07:164N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at 85 
C*07:191N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
 
C*07:198N Point
Exon 2, 202-204AGA>TGA, causes R44X, premature stop at codon 44 
C*07:227N Point
Exon 2, 124-126GGA>TGA, causes 18GX, premature stop at codon 18 
C*07:264N Point
Exon 3, 535-537 CAG-TAG, causes Q155X, a premature stop at codon 155 
C*07:329N Point
Exon 3, 610C>T, causes Q180X, a premature stop codon 180 
C*07:347N Deletion
Exon 3, 537delG, in codon 155, causes a frame shift and a premature stop codon at 156 
C*07:350N Insertion
Exon 4, 706>707InsG, in codon 212, causes a frame shift 
C*07:393N Deletion
Exon 3, 564delC, in codon 158, causing frame shift and premature stop codon at 189 
C*08:26N Point
Exon 3, 451C>G, causes Y123X, a premature stop codon at 123Tissue Antigens (2011) 77:54-61
 
C*08:36N Insertion
Exon 3, 439-441TAC>TAG, causes Y123X, a premature stop at codon 123 
C*08:52N Deletion
Exon 4, 678delG, in codon 202, causes frameshift and premature stop at codon 215 
C*08:55N Point
Exon 2, 175-178CGG>TAG, causes R35X, a premature stop at codon 35 
C*08:88N Deletion
Exon 3, 421>427delGCCTACG, in codon 117>119, causes a frame shift and a premature stop codon at 124 
C*08:89N Insertion
Exon 2, 133>134InsC, in codon 21, causes a frame shift and a premature stop codon at 74 
C*12:39N Point
Exon 2, 250-252TGG>TGA, causes W60X, a premature stop at codon 60Tissue Antigens (2014) 83:184-189
 
C*12:46N Point
Exon 3, 424-429TAC>TAG, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
 
C*12:80N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 
C*12:84N Insertion
Exon 2, 202-204insA, in codon 44, causes frame shift and premature stop at codon 75 
C*12:104N Point
Exon 3, 502C>T, causes Q144X, a premature stop codon 144 
C*12:105N Point
Exon 3, 514G>T, causes E148X, a premature stop codon 148 
C*14:07N Point
Exon 3, 583-585TAC-TAA, causes Y171X, a premature stop at codon 171 
C*14:21N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
C*14:35N Point
Exon 3 361-363TGG>TGA, causes W97X, premature stop at codon 97 
C*14:47N Point
Exon 3, 471G>A, causes W133X, a premature stop at codon 133 
C*15:92N Point
Exon 3, 358C>T, causes Q96X, a premature stop codon at 96 
C*15:95N Point
Exon 2, 265C>T, causes Q65X, a premature stop codon in 65 
C*16:30N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87Tissue Antigens (2014) 83:184-189
 
C*17:27N Point
Exon 2, 295C>T, causes R75X, a premature stop codon at 75 
C*18:07N Point
Exon 3, 415C>T, causes Q115X, a premature stop codon at 115 
DOA*01:04N Deletion
Exon 2, 108delC, in codon 11, causes frameshift and premature stop at codon 37Tissue Antigens (2005) 66:242-5
 
DPB1*61:01N Point
Exon 2, 286-288GAG>TAG, causes E67X, a premature stop at codon 67Tissue Antigens (1996) 47:293-9
 
DPB1*64:01N Point
Exon 2, 106-108TAC>TAA, causes Y7X, a premature stop at codon 7Tissue Antigens (1997) 49:262-6
 
DPB1*120:01N Point
Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10 
DPB1*154:01N Point
Exon 2, 271C>T, causes Q62X, a premature stop codon at 62 
DPB1*159:01N Point
Exon 2, 361C>T, causes R92X, a premature stop codon at 92 
DPB1*161:01N Point
Exon 2, 340G>T, causes E85X, a premature stop codon at 85 
DPB1*216:01N Point
Exon 2, 319A>T, causes R78X, a premature stop codon at 78 
DPB1*218:01N Point
Exon 2, 151C>T, causes Q22X, a premature stop codon at 22 
DPB1*328:01N Point
Exon 2, 361C>T, causes R92X, a premature stop codon at 92 
DPB1*357:01N Point
Exon 2, 330C>G, causes Y81X, a premature stop codon at 81 
DPB1*382:01N Point
Exon 2, 166A>T, causes R27X, a premature stop codon at 27 
DPB1*401:01N Point
Exon 2, 330C>G, causes Y81X, a premature stop codon at 81 
DPB1*403:01N Point
Exon 2, 264G>A, causes W59X, a premature stop codon at 59 
DQA1*04:03N Point
Exon 2, 236-238AAA>TAA, causes Q53X, a premature stop at codon 53Tissue Antigens (2004) 63:609-11
 
DQB1*02:18N Point
Exon 2, 279G>A, causes W61X, a premature stop codon at 61 
DQB1*02:20N Point
Exon 2, 376C>T, causes R94X, a premature stop codon at 94 
DQB1*03:66N Point
Exon 2, 278G>A, causes W61X, a premature stop codon at 61 
DQB1*03:84N Point
Exon 2, 662G>T, causes E176X, a premature stop codon at 176 
DQB1*03:90N Deletion
Exon 2, 240delG, in codon 48, causes a premature stop codon at 50 
DQB1*03:95N Deletion
Exon 2, 183delG, in codon 29, causes a premature stop codon at 67 
DQB1*03:118N Point
Exon 2, 207C>A, causes Y37X, a premature stop codon at 37 
DQB1*04:25N Point
Exon 2, 271G>T, causes E59X, a premature stop codon at 59 
DQB1*05:41N Point
Exon 3, 449C>A, causes S118X, a premature stop at codon 118 
DQB1*06:26N Point
Exon 2, 181-183AGA>TGA, causes R29X, a premature stop at codon 29 
DQB1*06:54N Point
Exon 2, 279G>A, causes W61X, a premature stop codon at 61 
DQB1*06:75N Point
Exon 2, 276C>G, causes Y60X, a premature stop codon at 60 
DQB1*06:77N Point
Exon 2, 253C>T, causes Q53X, a premature stop codon at 53 
DQB1*06:102N Point
Exon3, 488G>A, causes W131X, a premature stop at codon 131 
DQB1*06:112N Point
Exon 2, 124C>T, causes Q10X, a premature stop codon at 10 
DQB1*06:144N Point
Exon 2, 207C>A, causes Y37X, a premature stop codon at 37 
DQB1*06:158N Point
Exon 2, 196C>T, causes R34X, a premature stop codon at 34 
DRB1*01:33N Deletion
Exon 2, 123delG, causes frameshift and premature stop codon at 50Tissue Antigens (2011) 78:463-464
 
DRB1*01:39N Point
Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9 
DRB1*01:40N Point
Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9 
DRB1*01:52N Point
Exon 2, 336-338 TAC-TAG, causes Y83X, a premature stop at codon 83 
DRB1*01:62N Point
Exon 2, 270G>A, causes W61X, a premature stop codon at 61 
DRB1*03:67N Point
Exon 2, 268-270TGG>TGA, causes W61X, a premature stop at codon 61 
DRB1*03:68N Point
Exon 2, 367-369CGA>TGA, causes R94X, a premature stop at codon 94 
DRB1*04:81N Deletion
Exon 2, 296-297delAG, in codon 70, causes frameshift and premature stop at codon 86 
DRB1*04:94N Point
Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78Tissue Antigens (2011) 78:226-227
 
DRB1*04:119N Point
Exon 2, 334-336TAC>TAG, causes Y83X, a premature stop at codon 83 
DRB1*04:120N Point
Exon 2, 319-332TAC>TAA, causes Y78X, a premature stop at codon 78 
DRB1*04:142N Point
Exon 2, 336C>A, causes Y83X, a premature stop at codon 83 
DRB1*04:157N Point
Exon 2, 321C>A, causes Y78X, a premature stop codon at 78 
DRB1*04:158N Insertion
Exon 2, 304-305insG, in codon 73, causes a frame shift and premature stop codon at codon 87 
DRB1*04:178N Insertion
Exon 2, 318>319insC, in codon 87, causes frame shift and premature stop codon at 87  
DRB1*04:186N Point
Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78  
DRB1*07:10N Deletion
Exon 2, 175-176delTG, in codon 30, causes frameshift and premature stop at codon 32Immunogenetics (2007) 59:507-10
 
DRB1*07:26N Insertion
Exon 2, 172>173insA, in codon 29, causes a frame shift and a premature stop codon at 33 
DRB1*08:60N Deletion
Exon 2, 341delT, in codon 85, causes frameshift and premature stop at codon 99  
DRB1*11:169N Deletion
Exon 2, 326-327delGA, in codon 80, causes frameshift and premature stop at codon 86 
DRB1*12:24N Point
Exon 2, 268-270TGG>TAG, causes Y61X, a premature stop at codon 61Tissue Antigens (2011) 78:45-48
 
DRB1*12:31N Point
Exon 2, 127-129GAA>TAG, causes E14X, a premature stop at codon 14 
DRB1*13:113N Deletion
Exon 2, 246delG, causes frameshift and premature stop at codon 99 
DRB1*13:137N Point
Exon 2 298-300AGG>TAG, causes R71X, a premature stop at codon 71 
DRB1*13:142N Point
Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop at codon 64 
DRB1*13:185N Point
Exon 2, 223G>T, causes E46X, a premature stop codon at 46 
DRB1*14:92N Point
Exon 2, 190-192GAG>TAG, causes E35X, a premature stop at codon 35 
DRB1*14:137N Insertion
Exon 2, 304-305insG, in codon 73, causes frame shift and premature stop at codon 98Tissue Antigens (2013) 82:201-202
 
DRB1*14:152N Insertion
Exon 2, 303>304InsG, in codon 73, causes a frame shift and a premature stop codon at 106 
DRB1*15:17N Insertion
Exon 2, 294-295insGA, in codon70, causes frameshift and premature stop at codon 100Tissue Antigens (2005) 66:334-5
 
DRB1*15:50N Deletion
Exon 2, 303-304delGG, causes frameshift and premature stop codon at 97 
DRB1*15:80N Point
Exon 2, 301-303delG 304-306delG, in codon 71, causes frame shift and premature stop at codon 86 
DRB1*15:113N Point
Exon 2, 115C>T, causes Q10X, a premature stop codon at 10 
DRB1*15:115N Deletion
Exon 2, 295-296delGA, in codon 70, causes frameshift and premature stop at codon 86 
DRB1*16:13N Point
Exon 2, 241-243GAG>TAG, causes E52X, a premature stop at codon 52Tissue Antigens (2008) 71:180-2
 
DRB1*16:21N Deletion
Exon 2, 170-171delAA, in codon 28, causes frame shift and premature stop codon at codon 32 
DRB3*02:29N Deletion
Exon 3, 591-595delTGG G, in codons 167-168, causes frameshift and premature stop at codon 191 
DRB4*01:03:01:02N Point
Incorrect splicing results in lack of protein sequenceImmunogenetics (1990) 31:112-7
Tissue Antigens (1997) 49:152-9
Immunogenetics (1990) 31:112-7
 
DRB4*02:01N Deletion
Exon 2, 155-165delGGGTGC GGTTG, in codons 23-26, causes frameshift and premature stop at codon 29Immunogenetics (1997) 46:104-10
 
DRB4*03:01N Deletion
The allele contains sequence for intron 2 and exon 3, but has no preceding exon sequencesImmunogenetics (1997) 46:104-10
 
DRB5*01:08N Deletion
Exon 3, 572-590delAAACAGTTC CTCGGAGTGG, in codons 162-168, causes frameshift and possible stop codon after 171Tissue Antigens (1997) 50:326-33
 
DRB5*01:10N Deletion
Exon 2, 326- 327delGA, in codon 80, causes frameshift and premature stop at codon 86Tissue Antigens (2000) 55:467-9
 
G*01:05N Deletion
Exon 3, 460delC, in codon 130, causes frameshift and premature stop at codon 171Immunogenetics (1997) 45:464-5
Immunogenetics (2006) 58:241-51
 
G*01:13N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54Tissue Antigens (2008) 72:491-505
 
MICA*063N Point
Exon 2, 184-186CAG>TAG, causes Q39X, a premature stop at codon 39Tissue Antigens (2011) 78:297-298
 
MICA*064N Point
Exon 4, 799-801TGG>TGA, causes W244X, a premature stop at codon 244Tissue Antigens (2012) 79:313-314
 
MICB*009N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170Immunogenetics (1997) 46:499-508
 
MICB*021N Deletion
Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89Tissue Antigens (2004) 64:276-80
 
TAP1*01:02N Deletion
Exon, 599delG, in codon 200, causes frameshift and premature stop at codon 228J Clin Invest (1999) 103:755-8
 

Alternatively Expressed Alleles

Allele Mutation      Description of Mutation References
A*01:01:38L Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which results in low expression 
A*01:147Q Point
Exon 3, 564C>G, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:01:01:02L Point
Promoter Region, g-101T>C, causes a mutation in the Enhancer B region of the promoterHum Immunol (1994) 41:69-73
Tissue Antigens (2006) 68:442-5
 
A*02:01:14Q Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which may may effect expression 
A*02:293Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionTissue Antigens (2011) 78:267-270
 
A*02:440Q Point
Exon 3, 562T>C, causes C164R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:500Q Point
Exon 3, 562T>C, causes C164R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*03:200Q Deletion
Exon 3, 541>543delAGA, in codon157 
A*11:50Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*11:52Q Deletion
Exon 2, 103-105delTCC, causes deletion of codon 11, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionTissue Antigens (2011) 78:195-202
 
A*11:170Q Point
Exon 3, 564C>G, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*11:182Q Point
Exon 3, 563G>T, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*23:19Q Point
Exon 3, 619G>A, in codon 183, mutation occurs at exon boundary, potentially affecting the splice site and affecting expression 
A*24:02:01:02L Point
Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3Tissue Antigens (2004) 63:589-91
J Immunol (1997) 158:5242-50
Tissue Antigens (1997) 50:340-6
Transplantation (1999) 67:1336-41
 
A*24:02:03Q Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which may may effect expressionTissue Antigens (2003) 61:325-9
 
A*30:14L Point
Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*32:11Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionTissue Antigens (2006) 68:518-20
 
A*33:03:03Q Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which may may effect expressionTissue Antigens (2009) 74:432-434
 
B*15:218Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2014) 83:184-189
 
B*15:245Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*15:321Q Deletion
Exon 4, 742>753delCAAACTCAGGAC, in codons 224>227 
B*35:65Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionImmunogenetics (2006) 58:929-31
 
B*37:16Q Point
Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2014) 83:184-189
 
B*38:55Q Point
Exon 3, 373T>C, causes R101C, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*39:01:01:02L Deletion
Promoter region, g-151-152delTC, causes a decrease in promoter activity and low expression of the allele is seen 
B*39:38Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2006) 68:518-20
 
B*40:133Q Point
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2014) 83:184-189
 
B*44:02:01:02S Point
Intron 4, g1934A>G, causes an incorrect splicing leading to the deletion of exon 5Tissue Antigens (2004) 63:173-80
 
B*44:138Q Deletion
Exon 3, 353-355delCCC, causes deletion of codon 94, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*44:160Q Point
Exon 3, 562>564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*46:51Q Point
Exon 3, 564C>G, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*51:173Q Point
Exon 3, 374G>A, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
C*02:25Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
C*02:67Q Point
Exon 3, 373>375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
 
C*03:22Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2006) 67:343-5
 
C*03:169Q Point
Exon 3, 373>375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
 
C*03:244Q Point
Exon 3, 563G>T, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
C*04:59Q Point
Exon 3, 562-564TGC>TAG, causes C161Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
C*05:51Q Deletion
Exon 3, 553-567delGAGGGCACGTGTGCGTG, causes deletion of codons 161-165, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*06:74Q Point
Exon 3, 562>564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
 
C*07:121Q Point
Exon 3, 562-564TGC>CGC, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
C*07:150Q Insertion
Exon 3, 499-500insCCCAGCGCAAGGTCAGATCA, in codon 143, this change may affect the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2012) 79:50-57
 
C*07:235Q Point
Exon 3, 562>564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*08:70Q Point
Exon 3, 373>375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
 
C*12:42Q Point
Exon 3, 562-564TGC>TGG, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
 
C*15:32Q Point
Exon 3, 562-564TGC>GGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*15:84Q Deletion
Exon3, 550>555delCTGGAG, in codon 160>161, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*15:96Q Point
Exon 3, 563G>A, causes S164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*16:16Q Point
Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
DQB1*03:91Q Insertion
Exon 2, 594>595InsACTCCCCA, in codon 167, No internal stop codon 
DQB1*03:99Q Deletion
Exon 2, 189>191delCTA, in codon 31>32, No internal stop codon 

Describing the mutations

The following recommendations are used for describing mutations in nucleotide sequences;

Mutations in protein sequences follow a similar format;